which of these events happended first?

Which Of These Events Happended First?

Answers

Answer 1
the great Pompeii was started

Related Questions

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

Other Questions
Find the circumference of the circle.please help me baby The biosphere includes all the water in the oceans.A.) FALSE - it contains all the living organismsB.) FALSE - it contains all the land and soilC.) FALSE- it contains all the gasesD.) True HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAPHELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP Help me with this please Write 214 as a mixed number. Give your answer in its simplest form. Which of the following is a characteristic of attention deficit/hyperactivity disorder (AD/HD)?1. has difficulty waiting for his or her turn2. lacks facial expression3. is unusually sensitive to light, sound, and touch4. performs repetitive movements, such as spinning, rocking, or hand-flapping Part 3. Use side to determine if the triangles in each pair are similar. If so, complete the similarity statement. NO LINKS.!!!! i hope u can help meeeee!!! Write this number in standard form: 6,000,000 + 900,000 + 80,000+ 9,000 + 500+ 80+ 2 Omg please help this is IMPORTANT 2A payment increases from $700 to $945. What is the percent increase in thepayment? Show your work. Brenda bought three time more black fabric than red fabric. She bought 72 inches of red fabric. If fabric costs 7.25 per yard, how much did Brenda spend on fabric Random Hispanic Question-Yall does anyone know why Hispanic parents are always tryna scare us with El chupacabra or La llorona or ell cucuy? Like why they tryna scare the hell out of us!? grhfygguxfrides at War that make up the construction on the lines What are the quarrelsome man's punishments for his rude behavior ? The elves of old Mexico 1. Metabolic pathways Metabolism of ketone bodies involves several different pathways, such as the production of glucose (gluconeogenesis), the oxidation of fatty acid, and the citric acid cycle. All of these pathways are part of energy metabolism, which is composed of reactions involved in generating or storing metabolic energy. There are two major divisions in metabolism: 1. processes in which complex substances are degraded to simpler molecules accompanied by the net release of chemical energy and 2. processes concerned primarily with the synthesis of complex organic molecules, which requires a net input of chemical energy. Some pathways, such as the citric acid cycle, can serve in both functions. Oxaloacetate is an important intermediate in several of these pathways, especially the citric acid cycle. Depleted oxaloacetate, just like other citric acid cycle intermediates, has to be replenished to maintain flux through the cycle. Separate metabolic pathways serve this purpose by balancing the flow of carbon in and out of the cycle. Define the major metabolic pathways by completing the sentences. Match the words in the left column to the appropriate blanks in the sentences on the right. a. catabolic b. anabolic c. anapleroticd. amphibolic 1. A(n)____process is the process in which complex biomolecules are built up from simpler.2. The____pathway involves both catabolic and anabolic processes. 3. A(n)____process is the process that replenishes the stores of citric acid cycle intermediates. 4. A(n)____process is the process by which complex molecules are broken down to simpler ones. 2. Identify the reactants and products of the citrate synthase reaction in Step 1 of the citric acid cycle. Drag the appropriate participants to their respective bins. a. acetyl-CoAb. citratec. heatd. CoA-SHe. oxaloacetate1. Reactants 2. Products 3. Neither 3. Mechanism for elevated ketone formationAfter analyzing the role of oxaloacetate in the first step of the citric acid cycle and formation reactions of ketone bodies above, your research group proposed several possible mechanisms for increased ketone bodies levels when oxaloacetate is depleted. Based on the information about ketone body synthesis, predict which possibility is the most reasonable. A. Another molecule (unknown at this point) reacts with available acetyl-CoA to form acetone, one of the ketone bodies. B. Lack of oxaloacetate frees the enzyme, citrate synthase, to be diverted to catalyze the formation of the ketone bodies. C. Oxaloacetate is unavailable to react with acetyl-CoA, resulting in acetyl-CoA being converted into acetoacetate, one of the ketone bodies. D. Oxaloacetate is an inhibitor of the enzyme catalyzing ketone body formation, thiolase; a lack of oxaloacetate activates the enzyme and increases the production of the ketone bodies. 4. Replenish oxalate in animals What enzyme catalyzes the reversible, biotin-dependent carboxylation of pyruvate to give oxaloacetate in animals?a. pyruvate carboxylase.b. phosphoenolpyruvate carboxylase.c. malate dehydrogenase.d. phosphoenolpyruvate carboxykinase. find the radius of the circle with center (2,2) that passes through (-9,-4) How can the writer add parallelism in this passage?O by changing the phrase "young people to "mostpeople" in sentence 1O by deleting the words obvious and potentially fromsentence 3O by deleting "save lives" and adding the phrase"easy to administer" to the end of sentence 6O by shortening the passage to only five sentencesby removing sentence 5 Can someone help on this? Celia uses 80% of her paycheck to pay her bills. Her bills total $272. How much is Celia paycheck?