Which of the following is a characteristic of attention deficit/hyperactivity disorder (AD/HD)?

1. has difficulty waiting for his or her turn
2. lacks facial expression
3. is unusually sensitive to light, sound, and touch
4. performs repetitive movements, such as spinning, rocking, or hand-flapping

Answers

Answer 1

Answer:

its the first one

Explanation: i have adhd lol

Answer 2

Answer:

it's answer number one owo

Explanation:


Related Questions

Drag each label to the correct location.
Identify the types of clouds shown in the image.
altocumulus
Cirrus
stratus
high
clouds
middle clouds
low clouds
middle
clouds

Answers

Answer:

The high clouds are cirrus,

The middle clouds are cumulus,

And the low clouds is stratus.

Explanation:

High clouds are cirrus, middle clouds are cumulus, and the low clouds are stratus.

What are the different types of clouds?

There are several types of clouds, classified based on their height, shape, and composition. Here are the main types of clouds:

Cirrus clouds: Thin, wispy clouds high up in the atmosphere, composed of ice crystals.Cumulus clouds: Puffy, white clouds that can resemble cotton balls. Stratus clouds: Low-level clouds that form a uniform, gray layer in the sky. Alto clouds: Middle-level clouds that are composed of water droplets and sometimes ice crystals. Cumulonimbus clouds: Towering clouds that can reach high into the atmosphere, often associated with thunderstorms, heavy rain, hail, and lightning.Stratocumulus clouds: Low-level clouds that are often arranged in rows or patches, resembling scales or fish scales.Nimbus clouds: These are dark, gray clouds that are associated with rain or snowfall.

Thus, the high clouds in the image are cirrus, the middle clouds are cumulus, and the low clouds are stratus.

Learn more about clouds, here:

https://brainly.com/question/1558130

#SPJ5

a food web is shown below. Which of the following organisms compete for the mouse as a food source?

Answers

Answer:

it should be the snake bc I have one and the mouse gets eat in by the snake

According to the food web in the diagram, the hawk and the snake are the organisms competing for the mouse as a food source.

FOOD WEB:

A food web is a interaction of many food chains. It shows the feeding pattern of different levels of organisms.

Ideally, producers are fed on by primary consumers, followed by secondary consumers, then tertiary consumers.

In the food web attached to this image, two arrows connects hawks and snakes to the mouse. This means that hawks and snakes are potential predators or consumers of mouse.

Therefore, the hawk and the snake are the organisms competing for the mouse as a food source.

Learn more about food web: https://brainly.com/question/20472214?referrer=searchResults

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

If all grasshoppers are removed from the food chain, what will happen to the blue birds

Answers

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

Answer:

If all grasshoppers are removed from the food chain...the bluebirds will decrease in numbers.

Explanation:

I hope that this has helped you to understand your question. If you have any further questions, please put them below.

Have a great rest of your day/night!


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

What is climate change? O A. Lange-scale changes to weather patterns B. Increasing temperatures only C. Natural cycles of cooling and heating D. Decreasing temperatures only ​

Answers

Answer:

C. Natural cycles of cooling and heating is the best option.

Explanation:

C. is the only answer that describes climate, the others describe weather. Climate is natural conditions over a long period of time while weather is over a short period of time.

Please give brainliest.

True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.

Answers

i believe it is true
If haves to be true

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

Atoms from sugar molecules may combine with other elements via chemical reactions to form other large carbon-based molecules

Answers

Answer:

Yes.

Explanation:

Yes, carbon atoms from sugar molecules combine with other elements through chemical reactions to form other large carbon-based molecules. Sugar molecules comprise of carbon, hydrogen, and oxygen atoms. The hydrocarbon of sugar molecules are used to make amino acids and other carbon-based molecules that can be combine into larger molecules such as DNA molecule.

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

Trade winds blow from the horse latitudes toward the______.
equator
the tropics
the poles

Answers

Answer:

the correct answer is the equator

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

What is the greenhouse effect?


A
Greenhouse gases trap in oxygen and warm Earth.

B
Greenhouse gases trap infrared radiation and warm Earth.

C
Greenhouse gases trap UV radiation and cool the Earth.

D
Greenhouse gases trap carbon dioxide so plants can grow.

Answers

Answer:

B.

Explanation:

due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

Which of the following cells would be found in connective tissue?


Osteocytes


Goblet cells


Mucous cells


Neuroglial cells

Answers

Explanation:

the common cell types in connective tissue include: fibroblasts, mast cells, plasma cells, macrophages, adipocytes, and leukocytes. Slide 72 Tendon. Fibroblasts are the most common cell type of connective tissue. They produce both fibers and amorphous ground substance.

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Other Questions
If 2^2x = 2^3, what is the value of x? NEED ANSWERS ASAP TO THSESE FIVE QUESTIONS 80 POINTS1. Which sentence contains a word choice error?A. Whenever the cat howls, we know it wants to be fed right away.B. Sometimes the cat cannot decide among going out or staying inside.C. The cat likes to go out at any time it pleases and lets us know by crying.D. The cat likes to climb the tree but often gets stuck and needs help.2. Which sentence contains a word choice error?A. It is unclear weather the rain will continue or not this week.B. As the cold front continues throughout the day, rain will be heavy.C. Today will be rainy, but tomorrow will have abundant sunshine.D. The rain should have stopped by now according to the news report.3. Select the correct answer.Which sentence contains a word choice error?The mother was angry with1 her child for breaking the screen door.The man left a customary2 tip for the services rendered.The manager was not angry at3 the night shift because of the delay.The team was all ready4 for the opening game.A. 1B. 2C. 3D. 44. Which sentence contains a word choice error?A. Concerts in the park seem to be more enjoyable than going to an auditorium.B. The orchestra concert last night was the best one I have been to this year.C. We have decided to go see the concert anywhere despite the distance.D. The cello player was the lead for the main piece, and she played beautifully.5. Which sentence contains a word choice error?The salesman has no desire to go anywheres1 on his vacation.I would be willing to go anywhere2.They did everything3 when they went to Six Flags.Everyone4 on the tour visited the White House.A. 1B. 2C. 3D. 4 What was the intended effect of the Emancipation Proclamation? * Simon visits his local fast-food restaurant and orders a burger, a side, a drink and an ice cream. He can choose either a hamburger, a cheeseburger or a turkey burger; he can choose either potato chips, fries or salad as a side; he can choose one drink from coke, lemonade, sprite, or tea; and for his ice cream he can choose either a cone or a sundae.How many different possible meals could Simon choose? plz help plz plz plz The population of a city increases by 4.7% per year. If thisyear's population is 77,000, what will next year's populationbe, to the nearest individual? One theme in this excerpt from Isaac Asimov's "The Fun They Had" is remembering the past. Which sentence in the excerpt best reflects thistheme?Margie went into the schoolroom. It was right next to her bedroom, and the mechanical teacher was on and waiting for her. It was always on atthe same time every day except Saturday and Sunday, because her mother said little girls learned better if they learned at regular hours.The screen was lit up, and it said: "Today's arithmetic lesson is on the addition of proper fractions. Please insert yesterday's homework in theproper slot."Margie did so with a sigh. She was thinking about the old schools they had when her grandfather's grandfather was a little boy. All the kids fromthe whole neighborhood came, laughing and shouting in the schoolyard, sitting together in the schoolroom, going home together at the end ofthe day. They learned the same things, so they could help one another on the homework and talk about it.And the teachers were people....The mechanical teacher was flashing on the screen: 'When we add the fractions and "Margie was thinking about how the kids must have loved it in the old days. She was thinking about the fun they had. HERE"S MY NUMBER 4752512944 IM B.O.R.E.D: AND ILL GIVE YOU BRAINLIEST!! what does a psychiatrist do? Name the following alkane molecule:CH3CH(CH3)CH2CH(CH3)2A. heptaneB. 2,4,4-trimethylbutaneC. 2,4-dimethylpentane DirectionsWrite a 350-word argument essay that answers the question: Was the impeachment of a particular president justified,according to the Constitution? Be sure that you summarize the circumstances surrounding his impeachment and use thelanguage of the Constitution to explain your reasoning. Be sure to cite any and all reliable research properly and provide aworks cited page, using the APA Style Guide to guide your formatting. How do I find and solve this? Find x. ADD TEXT Find the 14th term of the sequence: 2, 4, 8, 16... a.4096b.8192c.16384d.65536 Identify the terminal point for a 30 angle in a unit circle. which factor most likely influenced the us congress to admit Louisiana as a state A commercial bank that offers customers checking and savings accounts iswhich type of financial institution?A. Investment institutionB. Contractual institutionC. Fractional institutionD. Depository institution Solve 8y+21=-14y+26 for y. Round your answer to the nearest tenth. Plz help me well mark brainliest if correct!!... Which description suggests that Daisy is a product of the Roaring 1920's?She's wealthy and has the leeway to pace her life with the colorful music season.O She's beautiful and has an opportunity to date a number of different menO She's young and wants to find a special person to spend her life with.O She's smart and will probably excel far beyond most other women that she knows How could you test your understanding of this passage?Most bikes can be easily modified to carry largeand sometimes unusualloads without difficulty. Modifications may be a matter of adding a rack or basket, or they may involve a specialized frame design. In addition to the modifications you saw in the pictures above, bicycles can also be modified by adding a trailer. Trailers are usually used for hauling goods or people. Bicycle taxis (often called pedicabs) and rickshaws are common in many places, including main street areas of some large cities in the United States, like Phoenix, Arizona, and Portland, Oregon.a.reread words in bold, or italicized, or headingsc.summarize the textb.reread unfamiliar wordsd.all of thesePlease select the best answer from the choices providedABCD