Which of the following is an example of a biotic factor interacting with an abiotic factor

Answers

Answer 1
I’m not sure what this question is referring to because the answer choices are not shown But abiotic factor Is Non- living such as the sun or water or rocks. biotic factors are living things, so humans, animals, or plants. An example of an abiotic & biotic interaction would be an animal drinking water or plants needing the sun for photosynthesis
Answer 2

Answer:

Example: tropical fish need warm water to survive.

Explanation:

(abiotic is nonliving, biotic is living)

fish is the living/biotic organism and water is the nonliving/abiotic thing.


Related Questions

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.

Answers

Answer:

d) excitabilidad

Explanation:

creo que seria esa no lo sé

no se mucho de eso

me dices si sale buena o mala

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

The biological selection of a particular allele for a trait to be passed to offspring has nothing do with the selection of the allele for another trait. Which of the following supports this statement?​

Answers

Answer:

1

Explanation:

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas


Which of the following is a way in which the atmosphere does NOT
interact with the hydrosphere? *
A). Decreasing the salinity of oceans from increased temperatures causing glacial
melting.
B). Developing hurricanes over warm ocean currents.
C).Increasing the amount of water evaporation from oceans and global temperatures
rise.
D). Gases moving sediment from hill tops

Answers

The correct answer is d. Please give me brainlest let me know if it’s correct or not okay thanks bye

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

based on questions 6 , 7 or 8 what happens to the voltage required in a circuit as the resistance decreases ? increases ?

Answers

Answer:

As the resistance decreases the Voltage Increases

Explanation:

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

Other Questions
Youve been given this piece of art to critique:Which statement would fit best in the analysis section of your critique?A. The subject matter is somewhat gruesome and troubling, even with the sense of hope that it offers.B. The artists name is Theodore Gericault.C. The main part of the composition relies on two triangle shapes.D. Gericault may have wanted to capitalize on the notoriety of the event to draw attention to his paintings. Which of the following would most likely NOT be part of the curriculum for someone studying to be a plant physiologist? Find the length of BC and CD in the above triangle Which was the significance of Woodstock in 1969? De un saco de frutas que contiene 3 naranjas, 2 manzanas, y 3 pltanos, una muestra aleatoria de 2 piezas de se selecciona la fruta. Si X es el nmero de naranjas e Y es el nmero de manzanas en la muestra, encuentre(a) la distribucin de probabilidad conjunta de X y Y, muestre la tabla de distribucin;(b) Pruebe que la suma de columnas y renglones nos entregan las distribuciones marginales de X , Y(c) Calcule P(Y = 0|X = 2).(d) Demuestre que las variables aleatorias X ,Y no son estadsticamente independientes What is the theme of the following poem? My love for you is like a raging sea So powerful and deep it will forever be Through storm, wind, and heavy rain, It will withstand every pain I WILL GIVE U BRAINLIEST AND THANKS AND 5 STARSplease help this is very importantthis is a big part of my grade how do you feel about testing? 1. In 1970, the U.S. Congress established The Environmental Protection Agency (EPA) to oversee all of the following, EXCEPT: *A.pollution problemsB.building new nuclear power plantsC.establish new environmental policiesD.research solutions to environmental issues find the equation of the graph plz urgent helppp Which pairs of numbers, whose sum is 35, have the largest product? A car salesman sells cars with prices ranging from $5,000 to $45,000. The histogram shows the distribution of the numbers of cars he expects to sell over the next 10 years. The salesman has observed that many students are looking for cars that cost less than $5,000. If he decides to also deal in cars that cost less than $5,000 and projects selling 200 of them over the next 10 years, how will the distribution be affected? A class has 16 boys and 20 girls. A prefect is to be chosen from the class. Ifeach student is equally likely to be chosen, calculate the probability that theselected prefect is:(a) a boy (b) a girl The speed of a car changes from 15 m/s to 55 m/s in 10 sec. find the Acceleration Rearrange x=2y-6 to make y the subject. What is the value of 9 inquinary number? A two-digit number is written at random. The probability that the number will be odd is . The probability that the number will be larger than 75 is . The probability that the number will be a multiple of 5 is . The probability that the number is even and less than 40 is . Lulu has raised 34 3 4 of the money she needs for a field trip. 12 1 2 of that money came from candy sales. What fraction of the total money needed for the field trip came from candy sales? what's the distance between (5,9) and (-4,2) a, b, and c are all vectors that have the same direction.a + b = cThe magnitude of a = 6 and the magnitude of b = 8. Find the magnitude of c.