Question 17 Multiple Choice Worth 5 points)
(0101 MC)
For many generations, a forest has been the home of a single species of bird, these birds primarily eat insects off the forest floor One year, humans living in the area accidentally introduce a new
species of bird to the forest. This new species has the same diet as the existing species. Which description predicts what will most likely result from these two species of bird living in the same
ecosystem?
Both bird species cannot occupy the same niche and therefore, one species will die of
D
O Both bird species would share the forest and have plenty of food and resources
One bird species will adapt and feed on different organisms in the forest
The established species will battle the introduced species of bird until death

Answers

Answer 1
I would say the second one
Unless this species of bird is very territorial then it would be the last one

Hope this helps!! :)

Related Questions

1. How does adaption help the animals?

Answers

Answer:

Explanation:

A sobrevivir

what element must a molecule contain to be considered organic?

Answers

Answer:CarbonExplanation:

Organic compound, any of a large class of chemical compounds in which one or more atoms of carbon are covalently linked to atoms of other elements, most commonly hydrogen, oxygen, or nitrogen. The few carbon-containing compounds not classified as organic include carbides, carbonates, and cyanides.

hope this help!

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

According to Jefferson, a government must _____.

A) hold free elections every four years
B) tax its citizens only with a valid reason for doing so
C) respect the rights of its citizens or risk being overthrown
D) provide security for its citizens in the form of a strong military

Answers

Answer:

C) respect the rights of its citizens or risk being overthrown

Explanation:

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

what structures found in the nucleus contain the genetic information of an organism

Answers

the nuclear envelope is a double membrane of the nucleus that encloses the genetic material it separates the contents of the nucleus from the cytoplasm the nuclear envelope is made of two lipid bilayers and membrane in an outer membrane

Explanation:

step-by-step explanation

HELP PLEASE!!! please keep it short

According to the sliding filament theory what happens to the sacromere during a muscle contraction?​

Answers

Answer:

A muscle fiber will contract when myosin filaments pull actin filaments closer together and thus shortening sarcomeres within a fiber.

What is RNA and list and explain the 3 different types of RNA.

Answers

Answer:

RNA is Ribonucleic acid

mRNA

rRNA

tRNA,

Explanation:

mRNA, or messenger RNA, that serve as temporary copies of the information found in DNA; rRNA, or ribosomal RNA, that serve as structural components of protein-making structures known as ribosomes; and finally, tRNA, or transfer RNA, that ferry amino acids to the ribosome to be assembled

PLS I need someone to upload a photo of the answer!

Answers

Answer:

See the file bellow

Explanation:

What is an apex predator?

a) A consumer eaten by no other species
b) A producer of the highest nutritional value
c) A consumer living at the top of a mountain
d) A consumer that eats more than one species

Answers

The answer is A because it is on top of the food chain
i believe it is A, since apex predators are at the top of the food chain! they have no natural predators.

At which points (A, B, C, or D) in the curve is light a limiting factor?

Answers

Answer:

D

Explanation:

Which of the following measurements is the most precise?
165mg
O 164.5mg
164.47mg

Answers

Answer:

164.47mg

Explanation:

Precise means the most accurate

Which statement describes one feature of chemical changes? They never change a substance’s properties. They change a substance’s identity. They can usually be reversed. They keep a substance’s arrangement of atoms the same.

Answers

They change a substance’s identity.

Answer:

They change a substance’s identity.

Explanation:

do woody stems die off each winter and grow back the next spring

Answers

no they can survive the winter

Which is true about all unicellular and multicellular organisms?
O They are made of one cell.
O They reproduce.
They cause infections.
O They are made of multiple cells.

Answers

They both reproduce

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

The burrowing owl is found in dry, open areas such as grasslands, prairies, savannas, deserts, farmlands, golf courses, and urban areas throughout most of western United States and Florida, Central America, and most of South America. It makes its home in burrows of other animals and primarily eats insects and small rodents. As humans build more cities, nearby burrowing owl habitats change due to destruction of burrows and loss of prey. Which is the least likely outcome of the habitat changes that are described?

Answers

Answer:

inside under ground holes in the ground

Explanation:

Answer:D

Explanation:

1)What is it about the structure of ATP that contributes to its ability to act as an energy currency?
2)When a phosphate is transferred from ATP, it can phosphorylate another molecule. How could this assist in allowing a protein to transport molecules against their concentration gradient?

Answers

Answer/Exlanation:

1) ATP (adenosine triphosphate) can be hydrolyzed such that it loses a phosphate group to form ADP (adenosine diphodphate). This is called ATP hydrolysis. This property allows ATP to act as energy currency because ATP hydrolysis releases the energy stored in the high energy phosphate bond.

2) Transporting molecules against their concentration gradient requires energy. When ATP loses its phosphate group, it can phosphorylate another molecule. This converts the molecule into its active state, giving that molecule the energy to pass through against the concentration gradient.

1) The ability of the ATP compound structure to act as an energy currency has been explained in the answers.

2) The method used by ATP to allow protein transport molecules against their concentration gradient has been explained below.

1) ATP is an acronym that stands for Adenosine triphosphate. This compound called ATP is divided into three phosphate groups with phosphate bonds that possess very high energy. Now, when water is added to ATP, the phosphate bonds that possess high energy will be broken down thereby releasing energy and producing adenosine diphosphate (ADP).

2) We saw above that when ATP undergoes hydrolysis, the phosphate bonds are broken down to form ADP and releases energy. However, it can undergo further phosphorylation to form another molecule which becomes energized when it goes to a higher energy state.

Now, In this higher energy state it gets to, it will be observed that the protein will possess enough energy to transfer molecules against a concentration gradient that requires energy.

Read more at; https://brainly.com/question/18116896

Like nutrients and water, energy also recycles through an ecosystem,True Or False?​

Answers

Answer:

Explanation:

True

A person who is optimistic:

O A. will make more money.
O B. believes that others control his or her fate. .
O C. will have successful relationships.
O D. will be healthier.

Answers

Answer:A

Explanation:

because optimistic people are confident about their future

Optimistic people believe that they will make more money. Therefore, option A is correct.

What is an optimistic person?

A person who is very confident and hopeful about his future and hopes for good outcomes is known as an optimistic person. They have faith in themselves and believe that they have the skills to make everything good. Optimists are happier than pessimists.

An optimistic person sees the positive side of everything. They believe their faith is in their own hands, and no one can control it. Their point of view is always positive. There are two types of optimistic people and that are comparative optimism and nihilistic optimism.

They believe that they will be successful and make more money in the future. Therefore, option A is correct.

Learn more about optimistic people, here:

https://brainly.com/question/14920129

#SPJ2

how long does it take a p-wave to travel 5,200 km?

Answers

Eight minutes twenty second

Explanation:

Feedback

what controls traits and inheritance

Answers

Answer:

In the explanation. :)

Explanation:

An organism's traits are controlled by the alleles it inherits from it's parents. Some alleles are dominant, while other alleles are recessive.

Hope this helps. Have a great day!

Urey and miller cooked a "primordial soup" with Hadean gases, water snd electricity to make _____,_____,_____ and_____

Answers

Answer:

Urey and miller cooked a "primordial soup" with Hadean gases, water and electricity to make glucose, acetic acid, amino acids and lipids.

Explanation:

In the Miller-Urey experiment, the aim was to reproduce the conditions of the earth before the existence of life, with the objective of demonstrating the formation of organic matter from inorganic molecules.

The scientists took water and gases present in the Hadean eon —previous to the existence of life— such as methane, carbon dioxide, hydrogen, nitrogen and even ammonia, the primordial soup. This mixture was subjected to electrical discharges, inside closed containers.

The results were some organic molecules, including glucose, acetic acid, amino acids and fatty acids. In these results the presence of macromolecules, such as proteins or nucleic acids, is not appreciated, however it was a significant contribution to the knowledge of the origin of life on earth.

what is the major nitrogen nous waste in humans​

Answers

Explanation:

urea

SUMMARY. Two major nitrogenous waste products, urea and ammonium (NH4+), are produced in humans when proteins are oxidized, and in this manuscript their excretions are examined from two perspectives.

What are the genotypes of the F1 parent plants?

Answers

F1 Parent Plant 1 genotype: F1 Parent Plant 2 genotype: 2. First, consider the gametes that each parent plant can create.

Click on "Embankment dam at a gold mine." Of the two opinions to consider in this case, which one presents a stronger argument? How does that help you make your final decision as the consulting dam engineer? What was your decision for this dam, as the consultant? How can you accomplish this and still stay within your budget? (Site 1)

Answers

Answer:  The strongest argument is the one that refers to security of people. This helps me to make a final decision, to ensure that there will be no accidents and guarantee that the mine will be used to generate moeny. So my decision is to repair it but choose to repair only the most urgent parts, to still stay within the budget.

Explanation:

A gold mine is a place where gold is extracted from the ground. Because of its value, the extraction of gold generates economic and social benefits all over the world, which has made this activity one of the most important in the world. There are also many ways of extracting this mineral.

The best argument will be the one that indicates the greatest concern for the safety of the citizens of that city or town. If there is a dam, it should be repaired in the best possible way. This will ensure the safety of the town and guarantee that the mine continues to be used, to generate economic benefits. Then, if the gold mine continues to be used even if it is not productive as it was, it must be repaired. However, in order not to make large expenditures and have a low budget for repair, I can choose to repair only the most urgent or necessary part.

So, the strongest argument is the one that refers to security of people. This helps me to make a final decision, to ensure that there will be no accidents and guarantee that the mine will be used to generate money. So my decision is to repair it but choose to repair only the most urgent parts, to still stay within the budget.

How do genetics (genetic predisposition) and the environment work together to cause substance abuse in individuals? What is the likely role of epigenetics in this process?

Answers

Answer: The drug abuse is influenced by the environment and exerts influence on the gene expressions.

Explanation:

The genetic make up of the person is decides, which genes will be expressed and develop a trait in an individual. But this genetic expression can be influenced by the environmental factors like food, exposure to sunlight, and others. This study which relate environment with the genetic make up is called epigenetics. No person is drug addict by birth but the consumption of drug can influence the genetic make up and traits in a abuser. So here, the environment is influencing the genetic basis of a abuser.

in cell A, what is the structure labeled X?

Answers

Answer:

Yo i dont know but when someone does please help me bro

Explanation:

In cell A, the structure labeled X is a centriole.

Centrioles are cylindrical organelles found in animal cells, usually existing in pairs called the centrosome. They play a crucial role in cell division by organizing and forming the spindle fibers during the process of mitosis and meiosis.

Centrioles are involved in the separation of chromosomes, ensuring that each daughter cell receives the correct number of chromosomes.

Additionally, centrioles are essential for the organization of microtubules in the cytoskeleton, which provides structural support and maintains cell shape.

Their function in cell division and cellular organization makes centrioles vital components of animal cells.

Know more about centriole:

https://brainly.com/question/909799

#SPJ6

Structure that organizes motion of the chromosomes?

Answers

Answer:

Structure that organizes motion of chromosomes. Cytoplasm. Material in cell; contains chemical wealth: sugars, amino acids, and proteins a cell uses to carry out everyday activites. Vacuole. Saclike structure (large in animal cell); stores water, salts, carbs, and proteins. Plays a role in disposing waste.

Explanation:

There are various structures that are found present in a cell. And these structures have peculiar functions they carry out in the cell. Chromosomes are found in the nucleus of a cell. During cell division there is the needed movement of the chromosomes.

The structure that organizes motion of the chromosomes is the centriole

The centriole is a structure found in the animal cells near the nucleus that aid in the movement of chromosomes through the action of the microtubule and spindle fibres. They help to assemble these microtubules and spindle fibres to aid movement of chromosomes.

Learn more: https://brainly.com/question/24552946

Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule

Answers

Molecule dddddddddddddd
It is a molecule because you can already cross out cell and matter and atom.
Other Questions
An athlete kicks a soccer ball with a velocity of 24.2 m/s at a 26 degree angle from the ground.Find the horizontal component of the starting velocity. (Vx)Answer: I got was 23.71 or if you round it it'd be 23.72 but it still says that I'm wrong hiii! please answer both!! :)) Soojin is adding some lengths of wood she used for a project. The lengths of wood are 123, 334, and 214 feet. How much wood did she use in all?Please I need an answer quick for my into math Thanks guys! Near the beginning of the story, Morris says the monkey's paw was created by a fakir who "wanted to show that fate ruled people's lives, and that those who interfered with it did so to their sorrow." Does the conclusion of the story support or disprove this idea? Explain your answer using examples from the text. PLEASEEE HELP On a coordinate plane, the vertices of triangle ABC are A(3, 1), B(6, 4), C(2, 5). The vertices are translated 4 units to the right and down 3 units. 1. Write a rule, P(x, y) P'(x + a, y + b), that represents the translation.2. What are the coordinates after the translation? Which of the options would be considered evidence?( A )main ideas (B) examples (C)authors perspective and (D) questions read these lines from the excerpt again Can someone help me figure out this Which nervous system disorder is known as a mini stroke?A.encephalitisB.transient ischemic attackC.cerebral palsyDautismE.amyotrophic lateral sclerosis What does Kipling mean when he says the White Mans Burden is to seek anothers profit? A)Kipling fears that whites will become enslaved. B) Kipling thinks that imperial powers are not doing enough. C)Kipling is happy with the amount of money imperialism provides. D)Kipling sees imperialism as working for the benefit of others. The graph represents a persons heart rate in beats per minute during 30 minutes of exercise.A graph titled Cardiac Exercise. The horizontal axis shows time (minutes), numbered 3 to 30, and the vertical axis shows Heart Rate (b p m) numbered 15 to 150. The line starts at 75 b p m in 0 minutes, to 135 b p m from 6 to 25 minutes, and ends at 105 b p m at 30 minutes.Which statement best describes the relationship between heart rate and time during exercise?The heart rate increases for 6 minutes, remains constant for 19 minutes, and then gradually increases for 5 minutes.The heart rate decreases for 6 minutes, remains constant for 19 minutes, and then gradually increases for 5 minutes.The heart rate increases for 6 minutes, remains constant for 19 minutes, and then gradually decreases for 5 minutes.The heart rate remains constant for 6 minutes, increases for 19 minutes, and then gradually decreases for 5 minutes. Help! Ill mark you brsinly Helpppppppppppppppppppppppppppppp is 1.6868 irrational or rattional HELP PLS>:OWhich answer best expresses the effect of Britain passing the Tea Act of 1773? [A] The first shots of the American Revolution are fired, and war between the colonies and Britain begins.[B] The Sons of Liberty protest by dumping tea into Boston Harbor, which becomes known as the Boston Tea Party.[C] Samuel Adams and the Sons of Liberty call this the Boston Massacre to gain colonial support against the British.[D] Delegates meet at the First Continental Congress and demand that Britain repeal the Coercive (Intolerable) Acts. Create your own literal equation that contains distribution, addition/subtraetion, division, and at least 4 variables. Then chose a variable and solve your equation for it. When a child behaves in a way that is not typical of his or her age and developmental level, it is difficult for a teacher to know if there is a mental health problem becauseappropriate behaviors might be learned with more experience and practice.teachers are rarely qualified to identify mental health issues.observed behaviors cannot be reliably linked to mental health status.most atypical behavior can be attributed to cultural differences. Define:Producer-Consumer-Decomposer- Why did Osorio play stickball as a child, and why does he continue to play asan adult?Help me rn give me the correct answer Study the diagram.What is forming in the diagram?a fronta hurricanea thunderstorma tornado