Que neurotransmisor afecta directamente al musculo esquelético: * Acetilcolina Triptófano Adrenalina Serotonina Endorfina

Answers

Answer 1

Answer:

Acetilcolina

Explanation:

La acetilcolina es un neurotransmisor excitatorio producido por neuronas del sistema nervioso periférico, es decir, células nerviosas que conectan el sistema nervioso central (SNC) con los diferentes órganos. La unión de acetilcolina a receptores específicos localizados en células del músculo esquelético conocidos como 'receptores nicotínicos' desencadena la contracción del músculo. Los receptores nicotínicos pertenecen a una superfamilia de proteínas de canales iónicos activados a través de la unión a acetilcolina, lo cual desencadena la despolarización de células musculares esqueléticas. Por otra, parte, la acetilcolina también posee un rol inhibitorio en células musculares cardíacas, donde su unión a receptores especifícos llamados 'receptores muscarínicos' disminuye la frecuencia cardíaca.


Related Questions

Atoms from sugar molecules may combine with other elements via chemical reactions to form other large carbon-based molecules

Answers

Answer:

Yes.

Explanation:

Yes, carbon atoms from sugar molecules combine with other elements through chemical reactions to form other large carbon-based molecules. Sugar molecules comprise of carbon, hydrogen, and oxygen atoms. The hydrocarbon of sugar molecules are used to make amino acids and other carbon-based molecules that can be combine into larger molecules such as DNA molecule.


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

Drag each label to the correct location.
Identify the types of clouds shown in the image.
altocumulus
Cirrus
stratus
high
clouds
middle clouds
low clouds
middle
clouds

Answers

Answer:

The high clouds are cirrus,

The middle clouds are cumulus,

And the low clouds is stratus.

Explanation:

High clouds are cirrus, middle clouds are cumulus, and the low clouds are stratus.

What are the different types of clouds?

There are several types of clouds, classified based on their height, shape, and composition. Here are the main types of clouds:

Cirrus clouds: Thin, wispy clouds high up in the atmosphere, composed of ice crystals.Cumulus clouds: Puffy, white clouds that can resemble cotton balls. Stratus clouds: Low-level clouds that form a uniform, gray layer in the sky. Alto clouds: Middle-level clouds that are composed of water droplets and sometimes ice crystals. Cumulonimbus clouds: Towering clouds that can reach high into the atmosphere, often associated with thunderstorms, heavy rain, hail, and lightning.Stratocumulus clouds: Low-level clouds that are often arranged in rows or patches, resembling scales or fish scales.Nimbus clouds: These are dark, gray clouds that are associated with rain or snowfall.

Thus, the high clouds in the image are cirrus, the middle clouds are cumulus, and the low clouds are stratus.

Learn more about clouds, here:

https://brainly.com/question/1558130

#SPJ5

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

Can anyone help p,ease

Answers

Answer:

im not understanding :(

Explanation:

You need to add the chart to the question

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.

Answers

i believe it is true
If haves to be true

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

What is the greenhouse effect?


A
Greenhouse gases trap in oxygen and warm Earth.

B
Greenhouse gases trap infrared radiation and warm Earth.

C
Greenhouse gases trap UV radiation and cool the Earth.

D
Greenhouse gases trap carbon dioxide so plants can grow.

Answers

Answer:

B.

Explanation:

due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D


I GIVE BRAINLIEST


Which statement best explains the genetic variation that results from sexual
reproduction?

Answers

Answer:

offspring receive a mix of genes from two different parents !

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

What element would we not be able to shower without?

Answers

I believe in the idea of that and my answer of identity is on the math

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

Which of the following cells would be found in connective tissue?


Osteocytes


Goblet cells


Mucous cells


Neuroglial cells

Answers

Explanation:

the common cell types in connective tissue include: fibroblasts, mast cells, plasma cells, macrophages, adipocytes, and leukocytes. Slide 72 Tendon. Fibroblasts are the most common cell type of connective tissue. They produce both fibers and amorphous ground substance.

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

Trade winds blow from the horse latitudes toward the______.
equator
the tropics
the poles

Answers

Answer:

the correct answer is the equator

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

which tube processes contribute to increase genetic diversity?? please helpp me

Answers

Independent assortment and crossing over

a food web is shown below. Which of the following organisms compete for the mouse as a food source?

Answers

Answer:

it should be the snake bc I have one and the mouse gets eat in by the snake

According to the food web in the diagram, the hawk and the snake are the organisms competing for the mouse as a food source.

FOOD WEB:

A food web is a interaction of many food chains. It shows the feeding pattern of different levels of organisms.

Ideally, producers are fed on by primary consumers, followed by secondary consumers, then tertiary consumers.

In the food web attached to this image, two arrows connects hawks and snakes to the mouse. This means that hawks and snakes are potential predators or consumers of mouse.

Therefore, the hawk and the snake are the organisms competing for the mouse as a food source.

Learn more about food web: https://brainly.com/question/20472214?referrer=searchResults

If all grasshoppers are removed from the food chain, what will happen to the blue birds

Answers

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

Answer:

If all grasshoppers are removed from the food chain...the bluebirds will decrease in numbers.

Explanation:

I hope that this has helped you to understand your question. If you have any further questions, please put them below.

Have a great rest of your day/night!

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

What is climate change? O A. Lange-scale changes to weather patterns B. Increasing temperatures only C. Natural cycles of cooling and heating D. Decreasing temperatures only ​

Answers

Answer:

C. Natural cycles of cooling and heating is the best option.

Explanation:

C. is the only answer that describes climate, the others describe weather. Climate is natural conditions over a long period of time while weather is over a short period of time.

Please give brainliest.

Other Questions
Given that Segment BE is 5 units, find the indicated measures for angle 1, 2, and segment AC and AD. Which of the following has the greatest momentum? A road runner with the mass of 1.8 kg moving at a velocity of 6.7 m/ s A hare with the mass of 2.7 kg moving at a velocity of 7.5 m/ s The turtle with a mass of 91 kg moving at a velocity of 1.4 m/ s A tortoise at the mass of 275 kg moving at a velocity of 0.55 m/ s 20. What famous innovator was experimenting with image and sound before the turn of the century?A.Thomas JeffersonB.Thomas EdisonC.Benjamin FranklinD.Walt Disney Help pls Spanish 3 ........ hello please help ill give brainliest What is the total population in the United States and the soviet Union during the Cold War? how does electromagnetic energy travel? How do you use land for benefit? Describe the mode of formation of metamorphic rocks How does poverty lead to human right violation Which two values are located at the same point on a number line? 1/2 and 2 , 2/2 2 , 2/1 2 , 2/1 and 1 What is the correct meaning of the word rhetoric?Most people are tired of the repetitive rhetoric of political campaigns.A. style of speakingB. poll reportsC. false claimsD. fundraising events construction lasted from 1817 to 1832not funded by the Federal governmentstretched nearly 400 milesresulted in growth of cities and tradeall of these are describing How did the decolonization of the Indian subcontinent compare to thedecolonization in Africa?Ethnic boundaries and conflicts were erased.Nationalism led to the overthrow of colonial rule.Africa was politically stable while the Indian subcontinent was notEngland left them worse off technologically than they were before colonization How does Family Farm become self-sufficient The value of k is represented by the equation Malala didn't want the Taliban to know her name so when she was blogging she used a ________________________. Question 1 options: pseudonym ventriloquist creation brutality How is a whale more like a human than a fish? CHOOSE ALL THAT APPLY 1.warm blooded 2.breast feeds its young 3.spends much time out of the water 4.can hold its breath for long periods of time 1) Ions are formed between positive or negative charge.2) Which one is not an ionic compound?a) LiClb) MgBr 2c) CaOd) HCl3) Write down chemical formula of ionic compound between Potassium (K) and Sulfur (S)?4) How many valence electrons Group 1 elements have?5) When group 1 element want to become stable by forming an ion, what will be itscharge?6) How many valence electrons group 2 elements have?7) When group 1 element want to become stable by forming an ion, what will be itscharge?8) How many valence electrons group 16 elements have?9) When group 16 element want to become stable by forming an ion, what will be itscharge?10) List two properties of ionic compounds. The compound interest on the account with .01% interest rate in 5 yearscompounded quarterly with an initial deposit of $1,000.