Please help !!!! Please help!!!!! I gave extra points, if you put a link I will report you !

Please Help !!!! Please Help!!!!! I Gave Extra Points, If You Put A Link I Will Report You !

Answers

Answer 1

Answer:

7x+7+5x+14=13x+10

12x+21=13x+10

-12x       -12x

21=x+10

-10    -10

x=11

13(11)+10

angle 4=153

Step-by-step explanation:

I solved it by using my big brain.


Related Questions

Help please and no links

Answers

Answer:

1) should be B

2) should be C

Step-by-step explanation:

look at pic 10 pts will mark brainilest

Answers

Answer:

its a right angle and the area of it is 24

Step-by-step explanation:

How can you prove a triangle is an equilateral triangle? (4 points)

a
Use the distance formula to see if at least two sides are congruent.

b
Use the slope formula to see if any sides are perpendicular.

c
Use the distance formula to see if all three sides are congruent.

d
Use the slope formula to see if any sides are parallel.

Answers

Answer:c

Use the distance formula to see if all three sides are congruent.

Step-by-step explanation:

An equilateral triangle is a triangle which has three sides with the same lengths. If we check for congruence we are checking to see if all the sides are the same :)

To prove a triangle is an equilateral triangle by using  the distance formula to see if all three sides are congruent, the correct option is C

What is the congruent triangle?

Two triangles are said to be congruent if the length of the sides is equal, a measure of the angles are equal and they can be superimposed.

Given;

To prove a triangle is an equilateral triangle

Now, we have to use the distance formula: d = sqrt( (x2 - x1)² + ( y2 - y1 )²)

When 2 sides are congruent it could be a scalene triangle, so it is not enough. All 3 sides must be congruent.

Therefore, the answer will be by use the distance formula of triangle to see if all three sides are congruent.

Learn more about congruent triangles;

https://brainly.com/question/12413243

#SPJ6

In how many ways can 21 be expressed as the sum of 3 prime numbers?

Answers

Answer:

I think by using a prime factor tree

the measure of an angle and its complements are 13x and 17x write an equation then solve​

Answers

Step-by-step explanation:

Aal kimoya iyah I love 18

Find the volume of the composite solid. Round your answer to the nearest tenth.

Answers

Answer:

Volume = 646.0 cm³

Step-by-step explanation:

The solid is made up of a hemisphere and a cube

Therefore,

Volume of the composite solid = ⅔πr³ + a³

Where,

r = ½(8) = 4 cm

a = 8 cm

Plug in the values

Volume of the composite solid = ⅔*π*4³ + 8³

= 134.04 + 512

= 646.0 cm³ (nearest tenth)

A storage trunk is shaped like a rectangular prism. The trunk's volume is 18 cubic feet. The length of the trunk is 6 feet, and the width of the trunk is 2 feet. What is the height of this trunk

Answers

Answer:

1.5

Step-by-step explanation:

The height is 1.5 because to find the volume of a rectangular prism, you do length x width x height. Without height, you multiply length x width (6x2) and divide that by the volume (18 divided by 12 = 1.5)

What is 0.8 m3 when converted in cm3?

Answers

Answer:

80 cm3

Step-by-step explanation:

100 cm = 1 m

.8m * 100 - 80cm

What is g(x)?

A. g(x) = -x2
B. g(x) = -2
C. g(x) = -|x|
D. g(x) = -x

Answers

Answer:

C.

g(x) = -|x|

Step-by-step explanation:

Absolute value vertex. In this case, the vertex for y=−|x|y=-|x| is (0,0)(0,0)

The domain of the expression is all real numbers except where the expression is undefined. In this case, there is no real number that makes the expression undefined.

Interval Notation:

(−∞,∞)(-∞,∞)

Function is defined by f(x) = x2 - 4x + 8. The graph of function g is shown.
Let h represent the x-coordinate of the vertex of the graph of y = f(x). Let
represent the x-coordinate of the vertex of the graph of y = g(x). What is the
value of h-j?

Answers

The value of h -j is -5.

We have the function, f(x) = x² -4x + 8

Now, vertex

h = x = -b/2a

h = x = -(-4) / (-2)

h = x = -4/2

h= x = -2

Now, according to the graph

j = x= 3

So, h - j

= -2 - 3

= -5

Learn more about Function here:

https://brainly.com/question/30721594

#SPJ1

PLEASE HELP !!! ONLY AN HOUR LEFT

Answers

Answer: arc ef is 68

Step-by-step explanation:

Since EF and FG are the same length (given)

and DE and DG are the same length (both are radius of the circle)

and DF is a shared side, the 2 inscribed triangles are congruent, making angle EDF also 68

The measure of an arc is the same as the measure of the angle across from it

That question is a bit tricky but I think you that is a hard question

b1=5,b2=7,h=4
need help plz

Answers

Answer:

[tex]A=24[/tex]

Step-by-step explanation:

For finding the area of a trapezoid you first have to use the correct formula which is  [tex]A=\frac{1}{2}(b_1+b_2)h[/tex].

Now we plug in what we already know.

[tex]A=\frac{1}{2}(b_1+b_2)h\\A=\frac{1}{2}(5+7)(4)[/tex]

Now we start with the parenthesis

[tex]A=\frac{1}{2}(12)(4)[/tex]

Now if you can, you can multiply the 1/2 and the 12 and the 4 using a calculator or mentally

[tex]A=24[/tex]

Answer:

24

Step-by-step explanation:

I hope this helps!! and Sak! can u pls tlk to me in  my questions

Solve for x
A) 2
B) -10
C) 7
D) -3

Answers

X is -10
I hope it will help u
Brainliest pls

Answer:

-10

Step-by-step explanation:

corresponding angles.

hope the image attached helps

thank you

PLEASE PLEASE PLEASE! WILL MARK BRAINLIEST!!! PLEASE ANSWER!!! WRONG ANSWERS JUST FOR POINTS WILL BE REPORTED!!!!!!!!!!!!!! Really wanna get this over with only 1 more question after this

Answers

Answer: 621.72 in^3
V=pir^2h
3^2=9x22= 198x3.14
621.72

Required volume=352π or 1105.84in³

Answer:

solution given.:

radius of outer rim[R]=5in

radius of inner rim[r]=3in

height[h]=22in

we have

volume of Styrofoam collar[V]=volume of cylinder of (outer rim -inner rim)

=πR²h-πr²h=πh(R²-r²)=π×22(5²-3²)=352π or 1105.84in³

The figure is made by attaching semicircles to each side of an 11-ft-by-11-ft
square. Find the area enclosed by the figure. Use 3.14 for pi

Answers

Answer:

A=1164.62

Step-by-step explanation:

First you find the radius:

11*11=121

121=2*(22/7)*r

121=44/7*r

19.25=r

Then to find the area you:

A=22/7(19.25) to the 2 power
A=1164.62

PLSSSS HELP AND NOOOO LINKS OR SPAMMERS!!!! Write the equation of the line for the graph shown below.

Answers

B.None of these answers are correct(Please tell me if you got it right or wrong and I’m so very sorry if you didn’t)

PLEASE HELP AGAIN. IM TIMED

Answers

Answer:

B, 3 8/9

Step-by-step explanation:

It all comes down to equivalent fractions.

2 1/3 as an improper fraction is 7/3.

1 5/9 as an improper fraction is 14/9. 1/3 = 3/9.

With that being said 7 x 3 = 21 resulting in 21/9.

14/9 + 21/9 = 35/9.

35/9 as a mixed fraction is 3 8/9.

Which players' hit totals would you use to find the range?​

Answers

Answer:

17. a  18. c   19. d   20. b

Step-by-step explanation:

Hello, for the first question, you just take the person with the largest number and the person with the smallest number. Kenny (5) and Sammy (0).

For question 18, you just add up all the numbers like this:

0+1+3+5+4+1+1+2+1= 18

And then you divide it by the number of people there which is 9:

18/9=2

For question 19, you arrange all the numbers from least to greatest like this:

0,1,1,1,1,2,3,4,5

And then you count on both ends until it meets the middle. 1 is the middle.

For the last question, you just find the number that appears the most, which is one.

Hoshi has $50. Emily has $23 more than Hoshi. Karl has $16 less than Emily. How much money do they have all together?

Answers

Answer:

88

Step-by-step explanation:

50 - 23 = 27

27 - 16 = 11

50 + 11 + 27 = 88

A rectangle has side lengths of (3x+6) inches and (2x-4) inches. Write an expression to represent the perimeter of the rectangle. Then find the value of x if the perimeter is 94 inches.

Answers

the answer:
2 (3x+6) + 2 (2x+4)=94
6x+12+4x+8=94
10x+20=94
10x=74
X=74/10
X=37/5


b) Is the relation a function? Use the vertical line test to decide.

Answers

Answer:

Step-by-step explanation:

The answer is A U just did that on Khan academy

Answer: A

Step-by-step explanation:

An event that is guaranteed to happen has a probability of exactly

Answers

Answer:

100%

Step-by-step explanation:

It is confirmed to happen, or [tex]\frac{100}{100}[/tex]

Answer:

An event that is guaranteed to happen has a probability of exactly 1

QUESTION 6 of 10: Your plan for your T shirt business calls for you to be able to produce 60,000 screen printed shirts in a month. If each
screen press can handle 500 shirts per day, about how many presses do you need?
a) 2
b) 3
O c) 4
d) 5
оооо

Answers

Answer: 4

Step-by-step explanation:

I did 60,000 divide by 30 days equal 2000

2000 divide by 500 equals 4

There are 4 presses we need

we have given that the T shirt business calls for you to be able to produce 60,000

In a month there are 30 days

What is the meaning of the ratio?

the quantitative relation between two amounts showing the number of times one value contains or is contained within the other.

Therefore we have

[tex]\frac{60000}{30}=2000[/tex]

we have given that

each screen press can handle 500 shirts per day,

Therefore [tex]\frac{2000}{500}=4[/tex]

Therefore ,there are 4 presses we need

To learn more about the presses visit:

https://brainly.com/question/22451

For the equation, complete the given ordered pairs.

3x-y=4

{0,_} [1,_} {_,4}


Can someone help me

Answers

Answer:

{0,-4} [1,-1} {8/3,4}

Step-by-step explanation:

3x - y = 4

{0,_} [1,_} {_,4}

For x = 0:

3x - y = 4

0 - y = 4

y = -4

For x = 1

3x - y = 4

3 - 3 - y = 4 - 3

-y = 1

y = -1

For y=4

3x - y = 4

3x -4 = 4

3x = 8

x = 8/3

Solution:

{0,-4} [1,-1} {8/3,4}

Please mark brainliest if this helped!

Please mark brainliest if this helped!

Rectangle is graphed in the coordinate plane. The following are the vertices of the rectang A(- 2, 2), B(6, 2), C(6, 3) and D(- 2, 3) . What is the area of rectangle ABCD?

Answers

Answer:

Adenosine triphosphate

Answer:

The area of the rectangle ABCD will be 8 sq. units.

Step-by-step explanation:

The rectangle shape ABCD has vertices A(- 2,2), B(6,2), C(6,3) and D(- 2,3).  

Presently, length of side AB = [6 - (- 2)] = 8 units.  

{Since the line AB is corresponding to the x-pivot, so the length of the portion AB will be the contrast between the x-directions of the focuses An and B}  

Once more, line BC is corresponding to y-pivot and thus the length BC = (3 - 2) = 1 units.  

Subsequently, the space of the square shape ABCD will be (8 × 1) = 8 sq. units. (Answer)

The slope of the line below is 3. Write the equation of the line in point-slope
form, using the coordinates of the labeled point. Do not use parenthesis on
the y-side.
(-1,1)
-5
5
-5

Answers

Answer:

The equation of the line in point-slope form is [tex]y - 1 = m(x + 1)[/tex]

Step-by-step explanation:

Equation of a line:

The equation of a line, in point-slope form, is given by:

[tex]y - y_0 = m(x - x_0)[/tex]

In which the point is given by [tex](x_0,y_0)[/tex] and m is the slope.

The slope of the line below is 3.

This means that [tex]m = 3[/tex]

(-1,1)

This means that [tex]x_0 = -1, y_0 = 1[/tex].

Equation of the line:

[tex]y - y_0 = m(x - x_0)[/tex]

[tex]y - 1 = m(x - (-1))[/tex]

[tex]y - 1 = m(x + 1)[/tex]

The equation of the line in point-slope form is [tex]y - 1 = m(x + 1)[/tex]

server F, working 7 hours offers to join the group of five servers sharing their workload. If server F joins will the mean number of hours worked increase or decrease​

Answers

π I don’t really know the answer I’m really sorry

Duncan ran 26.2 miles in 4 hours 10 minutes. At this rate, rounded to the nearest tenth, how long did it take Duncan to run each mile?

Answers

Answer:

Time taken for cover 1 miles = 0.16 hour (Approx.)

Step-by-step explanation:

Given:

Total distance cover by Duncan = 26.2 miles

Time taken by Duncan = 4 hours 10 minutes

Find:

Time taken for cover 1 miles

Computation:

Time taken by Duncan = 4 hours 10 minutes

Time taken by Duncan = 4 + 0.167 hour

Time taken by Duncan = 4.167 hour

Speed = Distance / Time

Speed = 26.2 / 4.167

Speed = 6.28 miles/hour (Approx.)

So,

Time taken for cover 1 miles = 1/6.28

Time taken for cover 1 miles = 0.16 hour (Approx.)

2. What is the value of x? (y + 2.3) cm K G 7 cm (2.5x) H A. O 60 B. O 72 C.O 30 D.O 24​

Answers

Answer:

ITS B SORRY CAPS

Step-by-step explanation:

A submarine travels 5.5 km due East from its base and then turns and travels due North for 3.4 km.
How far away is the submarine from its base?
Give your answer rounded to 1 DP.​

Answers

Answer:

6.5km

Step-by-step explanation:

If you make a diagram, you'll see the submarine forms a right angle triangle with the base, where the hypotenuse is the length from the submarine to its base, and 5.5 and 3.4 are the side lengths. To find the hypotenuse, use the formula a^2+b^2=c^2.

5.5^2+3.4^=c^2

41.81=c^2

6.466=c

Round it to one decimal point and you get 6.5km.

Answer:

6.5km

Step-by-step explanation:

I think is this I am not really sure

Other Questions
Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution John wanted to buy his favorite rubber shoes. Its original price is $105. He is lucky today because the shoes that he wanted to buy is 30% off the original price. How much will John pay now for his shoes?