Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to

Answers

Answer 1

Answer:

A) social loafing.

Explanation:

social loafing is the event of a person exerting lower effort to accomplish the goal at the time when they work in a group rather working alone. It would be the important reasons for less productivity as compared with the combined performance that works as an individuals

So according to the given situation, Jacob reduce work output due to social loafing

Answer 2

Social loafing is the psychological phenomenon in which team members do less work in a group context.

How do you handle social loafing?

One of the most effective ways to decrease the possibility of social loafing is to form smaller groups or teams. Make it easy to see and support team members' work.

Smaller groups also allow people to create relationships and form a coherent entity, all of which motivate people to contribute.

Thus Option A is the reason for Jacob’s reduced work output.

For more information about social loafing refer to the link:

https://brainly.com/question/25493656?


Related Questions

G Brown has the following items in her balance sheet as on 30 April 20X8: Capital £18,400;

Creditors £2,100; Fixtures £2,800; Car £3,900; Stock of goods £4,550; Debtors £2,780; Cash at bank

£6,250; Cash in hand £220.

During the first week of May 20X8

(a) She bought extra stock for goods £400 on credit.

(b) One of the debtors paid her £920 by cheque.

(c) She bought a computer by cheque £850.​

Answers

Answer:

b

Explanation:

Let's pretend you have $1,200 a month to spend on rent. Be sure that there is at least
one apartment complex and one home on your list. Compare the three properties,
listing the pros and cons. Consider advantages or disadvantages related to the number
of bedrooms, location, amenities, and total floor space.
Which rental property would you choose based on your findings and why?

Answers

Answer:

Apartment 1:

pros:

- no previous tenants

- gym

fireplace

- garage

cons:

- 1 bedroom

- 1 bathroom

- no pool

- small kitchen

- no closet space

Apartment 2:

pros:

- pool

- 3 bedrooms

- 2 bath

- gym

cons:

- small bedrooms

- limited storage space

- holes in the wall

- mold

Apartment 3:

pros:  

- 2 bedroom

- 2 bathroom

- pool

- hot tub

- garage

- large kitchen space

- storage closets

cons:

- none

I'd choose apartment 3 based off of the things I found inside home. Everything is great and brand new, under $1,200 and exactly what to look for. It's the best choice out of all three options.  

Explanation:

I looked around for the answer to this question but couldn't find it. I created my own answer and got a 100. Hope this helps.

ACTIVITY 1
Multiple Choice: Choose the letter of the correct answer
1 It is all about discovering and satisfying your customers' needs and want while earning
a profit
A Marketing
B. Product C Promotion D Needs
2. These are the bundles of attributes and benefits designed to be offered to buyers to
satisfy their needs, wants, and demands
A Promotion B Products C Customer D Market
3 Making sure that they are specific and quantifiable so you can measure your progress
toward achieving them, belong to what step of marketing?
A Marketing objective B Identifying demographics C Defining place
4. What steps of marketing plan where you're referring to the entire set of activities that
inform people about your product/service?
A Marketing objective
B Choose your promotion strategy
C Develop a pricing strategy
5 Defined as the difference between what the customer gains from the product and what
the customers losses from the costs acquiring such a product
A Market
B Customer Value C Promotion​

Answers

Answer:

A. Marketing.B. Products.A. Marketing objectiveB. Choose your promotion strategyB. Customer Value.

Explanation:

Marketing is all about knowing what the customer wants and satisfying it by offering the relevant products.

Products are simply bundles of benefits that were designed to be able to satisfy the needs and wants of customers.

The marketing objectives specify what the goals need to be achieved when marketing so comparing reality against them helps show progress.

The promotion strategy shows the activities that will be undertaken during the marketing of your goods and services.

Finally, the customer value from a product is simply what benefit the customer received less the cost of receiving that benefit.

Faylene underwent heart surgery that included, among other measures, the implantation of a pacemaker in her chest. Faylene later alleged that the surgeon's negligence resulted in a serious infection. Faylene's insurance company stated that the Uniform Commercial Code (UCC) governed the dispute because at issue was a contract for a pacemaker, which is a good. The hospital responded that the claim was based on a contract for a surgery, which is a service, and was therefore covered by the common law. What result is most likely?

Answers

Answer: The court will apply the predominant purpose test and will probably hold that this was a contract for a service.

Explanation:

Any agreement written in a contract which binds two parties are usually followed strictly. Whatever is written in the contract cannot be changed or influenced in the court room because it would have been believed that both parties went through the contract terms before signing it. Even though one party wants to challenge it in court it would hold no water for a challenge.

The case between Faylene and the hospital was signed in a contract for a peacemaker surgery, the effects of it and being taken to court would yield no effect since it's what Faylene wanted and entered agreement into.

On March 1, Sara, a student, received a telephone call from ComputerChip, Inc. offering her a job for one year beginning on June 15, after completion of the school year. According to the personnel manager, she will have to move to California and be ready to start work at 8:00 a.m. on June 15. Should Sara ask for a letter confirming the telephone conversation if she accepts the offer immediately

Answers

Answer:

Yes, because the job offer is for longer than one year from March 1

Explanation:

Since in the question it is mentioned that Sara who is a student have offered a job on March 1 that begins on June 15 and she have to move to california for the job. So here the Sara  would ask the letter in the case when she accepted the offer immediately as the job offer would be more than one year i.e. from March 1

Therefore the above represent the answer

Four ways in which schools could promote entrepreneurship as a viable option to counteract unemployment

Answers

Answer:

Entrepreneurship is an important alternative to counteract unemployment. It not only gives provides employment to the entrepreneur but also provides jobs to others as well.

Explanation:

Entrepreneurship may be defined as the setting up of a business or a work looking out for making profit dealing with the risks and the challenges on its own.

Four ways in which the school can promote entrepreneurship as a viable option to counteract unemployment are :

build awareness and promote entrepreneurship among the students.Provide the benefits of being an entrepreneur and showing them the possibilities of setting up a business that can even provide jobs to others.Providing with valuable ideas and guidance regarding setting up a business and giving an overview of the current market trends and market study.Helping the students reach out to other entrepreneurs and also providing ways to get any financial aid to set up a business.

Four Ways through which Schools can promote Entrepreneurship include the following

Creation of entrepreneurship centres to provide consulting to non-profits and small businesses.Awareness creation through seminars and lectures on the importance of entrepreneurship as an alternative to paid employment. Host entrepreneurship contests where incentives are given.Inviting influential and professional entrepreneurs to give lectures.

What is Entrepreneurship ?

Entrepreneurship is defined as the process of starting up a business, and taking up the responsibility of financial risk with the hope of making profit.

Entrepreneurship is a potent means of reducing unemployment to the lowest minimum.

Entrepreneurship brings about creativity and as such value is created which leads to more wealth.

Learn more about Entrepreneurship at https://brainly.com/question/353543

Scenario: Fiscal Policy Consider the economy of Arcadia. Its households spend 75% of increases in their income. There are no taxes and no foreign trade. Its currency is the arc. Potential output is 600 billion arcs. Reference: Ref 13-11 (Scenario: Fiscal Policy) Look at the scenario Fiscal Policy. Suppose the government decides to tax its citizens. The tax multiplier is: Group of answer choices impossible to determine. zero, because changes in taxes have no effect on aggregate demand. greater than the government spending multiplier. less than the government spending multiplier.

Answers

Answer:

less than the government spending multiplier

Explanation:

Given :

Percentage spends  by a households for the increase in the income = 75%

So the mpc = 0.75

Potential output = 600 billion arcs

The government multiplier is = [tex]$\frac{1}{1-0.75}$[/tex]

                                                [tex]$=\frac{1}{0.25}$[/tex]

                                                = 4

The tax multiplier is = [tex]$\frac{c}{1-c}$[/tex]

                                 [tex]$=\frac{0.75}{0.25}$[/tex]

                                 = 3

Thus we see that the tax multiplier is less than the government spending multiplier.

can someone help with my accounting paper?​

Answers

sure.. where is it? can u show?

What is the legal maximum speed limit permitted when driving in a residential area of the community?
a. 15 mph
b. 25 mph
c. 35 mph
d. 45 mph
What is the legal maximum speed permitted for driving on the expressway-in Michigan?
a. 45 mph
b. 55 mph
c. 60 mph
d. 70 mph​

Answers

Answer:

B B :)

Explanation:

When comparison shopping, all of these hint at a good deal EXCEPT _____________________.

Answers

Answer: the sale price is the cheapest available.

Answer is …. there are more positive customer reviews than negative reviews.

Explanation:

Which of the following are examples of discretionary fiscal​ policy? ​(Check all that​ apply.) A. The government provides stimulus funds to repair roads and bridges to increase spending in the economy. B. Additional taxes are collected as the economy experiences an increase in income resulting from economic growth. C. Congress provides a tax rebate to encourage additional spending in order to reduce the unemployment rate. D. The president and Congress reduce tax rates to increase the amount of investment spending. E. A state government borrows money to finance the building of a new bridge. F. The government spends more on the military to provide assistance to England after a natural disaster.

Answers

Answer:

The government provides stimulus funds to repair roads and bridges to increase spending in the economy

The president and congress reduce tax rates to increase the amount of investment spending

Congress provides a tax rebates to encourage additional spending in order to reduce the unemployment rate

Explanation:

The following are examples of discretionary fiscal​ policy.

The government provides stimulus funds to repair roads and bridges to increase spending in the economy. Congress provides a tax rebate to encourage additional spending in order to reduce the unemployment rate.The president and Congress reduce tax rates to increase the amount of investment spending.

The correct options are A, C, and D.

What is discretionary and nondiscretionary fiscal policy?

Discretionary Fiscal Policy: changes in government spending and taxation enacted during a crisis affect the economy. Nondiscretionary Fiscal Policy: the set of policies built into the system to stabilize the economy, also known as automatic stabilizers.

These are deliberate policies implemented by the government to increase or decrease government spending or taxation. For example, when private sector demand and confidence are low during an economic downturn, Keynesian economists may advocate for a deliberate increase in the size of the fiscal deficit.

Thus, the ideal selection is options A, C, and D.

Learn more about discretionary fiscal policy here:

https://brainly.com/question/28136901

#SPJ2

When comparison shopping, all of these hint at a good deal EXCEPT_____________________.
lower-priced models offer more features.
there are more positive customer reviews than negative reviews.
there is a coupon available for additional percentage off the price.
the sale price is the cheapest available.

Answers

When comparison shopping, all of these hint at a good deal: lower-priced models offer more features.

What is e-commerce?

E-commerce is also known as an online sale and it can be defined as a type of business model that is designed and developed to involve the buying, shopping, and selling of goods (products) over the Internet.

What is comparison shopping?

Comparison shopping can be defined as a practice that is commonly embarked upon consumers of goods (products), in which they compare a range of available suppliers in order to identify the best price for a particular good (product) and influence their decision on who to patronize or buy from.

In this context, we can reasonably infer and logically deduce that lower-priced models offer more features does not indicate or suggest a good deal when a consumer is comparison shopping.

Read more on comparison shopping here: https://brainly.com/question/17596795

#SPJ1

Sales in 2015 1400000 at December 31,2015, before adjusting entire account receivable 250000debit allowance for doubt full account 2400 credit 2% net sales will prove uncollectible, prepare the December 31,2015, journal entry to record bad debt expense.

Answers

Answer:

Dr Bad Debt Expense $28,000

Cr Allowance for Doubtful Accounts $28,000

Explanation:

Preparation of the December 31,2015, journal entry to record bad debt expense.

Based on the information given the December 31,2015, journal entry to record bad debt expense will be :

Dr Bad Debt Expense $28,000

Cr Allowance for Doubtful Accounts $28,000

($1,400,000 *2%)

(To record bad debt expense)

The overriding aim in building a management team should be to: A. select people who are committed to decentralizing decision making and empowering employees. B. assemble a critical mass of talented managers who can function as agents of change and further the cause of first-rate strategy execution. C. choose managers experienced in controlling costs and flattening the organization structure. D. select people who have similar management styles, leadership approaches, business philosophies, and personalities. E. choose managers who believe in having a strong corporate culture and deeply ingrained core values.

Answers

Answer:

B. assemble a critical mass of talented managers who can function as agents of change and further the cause of first-rate strategy execution.

Explanation:

A team can be defined as a group of people or set of individuals with various skill set, knowledge and experience coming together to work on a project or task in order to successfully achieve a set goal and objective.

This ultimately implies that, a team comprises of individuals, workers or employees having complementary skills, knowledge and experience needed to execute a project or task successfully. Therefore, workers working as a team usually interact with the other team members and as a result, this enhances performance and strengthen the level of relationship they share.

A manager can be defined as an individual who is saddled with the responsibility of providing guidance, support, supervision, administrative control, as well as acting as a role model or example to the employees working in an organization by being morally upright.

Generally, managers are typically involved in taking up leadership roles and as such are expected to be build a strong relationship between their employees or subordinates by creating a fair ground for effective communication and sharing of resources and information. Also, they are required to engage their staff members (entire workforce) in the most efficient and effective manner.

Generally, the overriding aim in building a management team is to assemble a critical mass of talented managers who are able to typically function as agents of change while furthering the cause of first-rate strategy execution for the growth and development of a business firm or organization.

How does penetration pricing discourage rival companies from entering the market? (Select all that apply.) Multiple select question. It encourages price skimming, which is too risky for most companies to engage in. It negates the experience curve effect, which usually helps competitors. Competitors who enter the market will temporarily face higher unit costs. Usually none of the companies make much profit in this situation.

Answers

Answer:

Competitors who enter the market will temporarily face higher unit costs.

2. Usually none of the companies would make much profit in this situation.

Explanation:

Penetration pricing is a pricing strategy where the sellers of a new product set the price for their product unusually low. This is to entice consumers to purchase the product

Advantages of penetration pricing

it increases market share of the firm conducting the penetration pricing it increases the sales of the firm practicing the penetration pricing

Disadvantages of penetration pricing

Profit earned by the company might be too low once a low price has been set for the good, it might be difficult to raise it later as it may drive consumers away.

Price skimming is when the price of a new product is set usually high

1. Kwan's annual premium is $1,284.00. He has the choice of paying semi-annually for a $1.00 fee or quarterly for a $2.00 fee. What is his quarterly payment? Is it twice the amount ?

Answers

I’m not sure but I’ll try to solve it right now for you so just give me some time

The desire to earn a profit is called

A) making smart decisions

B) profit motive

C) business

D) entrepreneurship

Answers

Answer:

profit motive

Explanation:

on gawd

100 points
hurry

Pick a manufacturing job that interests you and in no less than 125-words, describe the job, explain the job’s part in its manufacturing industry, and justify why the job is necessary in that industry and must be performed well.

Answers

Answer

A brain surgeon

Explanation:

I picked this job because i find it amazing and it looking stisfiying cutting the perfict square and just relaxing.

A detective:

i also picked this job because i love solving mysteries and I love drama.

A CSI

i also picked this job because it makes me feel alive

Answer:

A brain surgeon

ExExplanation:

What would happen if a state or municipality suddenly lost its tax base? Explain if this would have any impact on it's cost of borrowing funds. Why?

Answers

Answer:

Following are the responses to the given question:

Explanation:

The tax base seems to be the amount that is added to both the income tax, that is which tax rate is the percentage of national economy collected as just a tax. Consequently, it is important to find an income tax that understands the tax base.

Whether this amount of tax would pay is not declared or decided if the state or city suddenly loses its local economy.

Impact mostly on the cost of credit

Its cost of debt before tax rebate funds = interest amount on the debt – any reduction in income tax which rose because of deductible profits. The costs of lending are real games calculated in anticipation of tax, however, the difference is DEDUCTIBLE in INTEREST EXPENSES.

This tax rate also increases the cost of lending and gives more income protection.

It's because when taxes become available, the company can save money on tax returns as it ultimately removes some profits.

Conclusion:

However it is lost about the tax base, however, the judgment could not be made afterward the amount to borrow as debt could be evaluated of that "TAX REVENUE OFFSET."

A bond issue with a face amount of $495,000 bears interest at the rate of 7%. The current market rate of interest is 8%. These bonds will sell at a price that is:

Answers

Answer: Less than $495,000.

Explanation:

The options are:

a. Equal to $495,000.

b. The answer cannot be determined from the information provided.

c. Less than $495,000.

d. More than $495,000.

It should be noted that a bond will be sold at a discount when the market interest rate is more than the stated interest rate.

Due to the lower interest rate, the investors will pay less for the bonds. Therefore, based on the information given, the bonds will sell at a price that is less than $495,000.

Therefore, the correct option is C.

A union declares it will be engaging in a partial strike whereby its employees will alternate between working for a period of time and then walking off the job for an indefinite time. Thus, employees may work for a few days or only a few hours before walking off the job again. The employer claims the union does not have the legal right to engage in a partial strike. Which statement is correct

Answers

Answer:

a. The employer is correct. The union must either strike or work—it cannot alternate between working and striking.

Explanation:

Since in the question it is given that that employee work for a less days or less hours prior walk off to the job again. Also the employer would claimed that the union does not have the legal right to have partial strike so here the employer is correct as the union could be do one thing at a time i.e. strike or work

So statement a is correct

The total estimated cost of attending a public two-year college in Hasani’s home town last year was $2,265. The cost of attending the college is expected to increase 5% annually. Hasani plans to enter the college this year and attend for 2 years. Which is the best estimate for the total cost Hasani will pay for only his second year? $2,270.66 $2,275.00 $2,491.50 $2,497.16

Answers

Answer: Hi there! For this question, we will be compounding, because the cost of going of going to college goes up by 5% each year. The formula for compounding is P(1 + r)^t, where P = starting amount, r = rate, and t = time in years. First, let's add 5% (0.05) to 1. 1 + 0.05 is 1.05. We are talking about how much Hasani will have to pay in his second year. We will raise that number to the 2nd power. 1.05^2 is 1.1025. Now, we will multiply that number by2,265 to find the amount. When we multiply both numbers, we get 2,497.1625 or 2,497.16 when rounded to the nearest hundredth. There. Hasani will pay an estimated cost of $2,497.16. The answer is D.

Answer:

D

Explanation:

To determine what the customers of a clothing store think about the variety of clothing sold in the store, a manager hands out a survey to 100 teenagers chosen at random who visited the store.
Which of the following could affect the outcome of the survey?
A. The survey is biased because the manager did not give the survey to teenagers at other stores.
B. The results could be flawed because the sample population was too large.
C. The results could be flawed because the sample is not a good representation of the store's customers.
D. The results could be flawed because the teenagers were randomly chosen

Answers

Answer:

C. The results could be flawed because the sample is not a good representation of the store's customers.

Explanation:

I just took the quiz, I hope this helps (:

The results could be flawed because the sample is not a good representation of the store's customers because it onlu says only  a manager hands out a survey to 100 teenagers chosen at random who visited the store.

What do you mean by Sample?

A sample is an unbiased visual value taken from humans. In simple terms, a population is the total number of observations (i.e., people, animals, objects, data, etc.) contained in a particular group or context.

Thus, Option C is the correct statement that is The results could be flawed because the sample is not a good representation of the store's customers.

To learn more about Sample refer:

https://brainly.com/question/24466382

#SPJ2

The ability to interact, be responsible, persevere, be a team player, be motivated, and problem solve are examples of _______________ skills valued by employers.
a. Trade
b. Technical
c. Critical
d. Automatic

Answers

Your answers should be B. Technical

Answer:

b. Technical

Explanation:

The ability to interact, be responsible, persevere, be a team player, be motivated, and problem solve are examples of technical skills valued by employers.

What are the location factors of coca-cola? (Give me 2-4 factors)

Answers

Answer:

Labor Productivity: ...

Exchange rates and Currency Risk: ...

Costs: ...

Political Risk, Values and Culture: ...

Proximity to Markets: ...

Proximity to Competitor:

In a private company's accounting system, inputs are __________ and outputs are _________. Multiple Choice marketing strategy-type information; sales data results of surveys on consumer satisfaction; accounts payables transactions such as sales, payroll, and other expenses; financial statements transactions such as the cash flow statement; payroll taxes

Answers

Answer:

Explanation:

transactions such as sales, payroll, and other expenses; financial statements

The correct answer is Inputs are accounts payables transactions such as sales, payroll, and other expenses; outputs are financial statements transactions such as the cash flow statement.

Here is a breakdown of the answer:

Inputs: These are the data that are entered into the accounting system. In a private company's accounting system, the inputs would typically include accounts payables transactions, such as sales, payroll, and other expenses.

Outputs: These are the reports and documents that are generated from the accounting system. In a private company's accounting system, the outputs would typically include financial statements, such as the cash flow statement.

The other options are not correct because they are not typically included in a private company's accounting system.

For example, marketing strategy-type information and results of surveys on consumer satisfaction is typically not included in the accounting system. Payroll taxes are also not typically included in the accounting system, as they are usually handled by a separate department.

Thus , accounts payables transactions and financial statements transaction is the correct options.

Learn more about transactions, here:

https://brainly.com/question/28391823

#SPJ6

hi thereeeeeeeeeeeeeeeeeeee

Answers

Answer: Hello nice to meet you!!!!!

Explanation:

Answer:

Periotttt yasss queen!!!

Explanation:

Warby Parker, an online retailer for prescription eyewear, offers a free, try-on at home program for its customers. Customers browse frames on Warby Parker's website and select five pairs they would like to try on. They can then choose to purchase or return the frames. Warby Parker handles all the shipping costs and provides all the return packaging. This relates to the ________ of its products.

Answers

Answer:

trialability

Explanation:

Since in the given situation it is mentioned that an online retailer offers for free try for his customers and the customers select five pairs theywant to try. Also they could select either for purchase or return

So here it related to the trail of its products where the customer could see whether the company product provide the satisfaction or not and according to this they take the decision whether to purchase the product or not

Hence, the last option is correct

Which method of payment actually is a form of borrowing money that
needs to be paid back later?*
5 points
O a. Cash
b. Credit Card
O c. Debit Card
O d. Check

Answers

Answer:

B. Credit Card

Explanation:

hope this helped

Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step

Answers

Answer:

determining the final price

Explanation:

In the given scenario Malcolm wants to use a pricing strategy that relies on his extensive experience and legal background rather than on time or effort spent on cases.

So he is promoting a higher quality of legal representation compared to other firms.

The next step in his pricing strategy will be to set the final price he wants to.offer his services.

This should be done by taking note of other law firms operating in the same community. A price that is too high will drive customers to competitors.

Other Questions
LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context.