Marla has 1\2 of a pound of candy. She equally distributes the candy into 4 bags. How much candy will go in each bag?

Answers

Answer 1

Answer:

1/8 or 8

Step-by-step explanation:


Related Questions

The four partners in a business decide to split the profits of their company in the ratio 2 : 3 : 3 : 5 .
If the profit one year is $26, 000, then what is the largest amount of profit received by one of the four partners?

Answers

Answer:

$10,000

Step-by-step explanation:

the profit was divided to 2+3+3+5=13 parts

the largest amount of profit

=$26,000×5/13

=$10,000

Solve x + 20 = 24.
The solution is x =

Answers

Answer:

4

Step-by-step explanation:

24 - 20 = 4

It’s would be x=4 because 20+4=24

An unknown number y is 15 more than an unknown number x. The number y is also x less than 8. The equations to find x and y are shown below.

y = x + 15
y = −x + 8

Which of the following statements is a correct step to find x and y?

and could somebody please give me a step by step explanation

Answers

Since both equations equal y, you can combine them to x+15=-x+8
Next you need to move both variables to the same side so you can subtract x from both sides so it would be 15=-2x+8
Now you want to get the variable alone so you’d subtract the 8 from each side of the equation and you’d be left with 7=-2X
Lastly you one just one x so divide each side by -2 and you’d have 7/-2=x
x= -7/2 or -3.5

Let me know if you want further explanation of how I got x.

Answer:

x = −3.5

y = 11.5

Step-by-step explanation:

y = x + 15

y = −x + 8

[We know that y is 15 units more than x, and that −x is 8 units less than y. That can be combined into −x + 8 = x + 15 for the first variable (x), and for the second variable (y), y − 15 = −y + 8]

In order to solve this, solve for the first variable in one of the equations, then substitute the result into the other equation.

x = −[tex]\frac{7}{2}[/tex] = −3.5

y = [tex]\frac{23}{2}[/tex] = 11.5

find the slope of the graph

Answers

Answer:

No image please add it on your next question.

saginosed
Rotate the given triangle 90°
counter-clockwise about the
origin
1 2 2
-1 3
1 1
-1 2.
[1
[ 2 2 )
(1
Enter

Answers

Answer:

-3

2 is the answer

Step-by-step explanation:

hope it helps

The required pairs of coordinates are  [tex]\left[\begin{array}{ccc}1&1&-3\\-1&2&2\end{array}\right][/tex]

What changes happened when rotate 90° counter clockwise ?

If we rotate a triangle 90° counter clockwise about the origin,

Then if one of its vertices be (x, y), it will be changed to (-y, x).

What is the required rotated vertex ?

After rotating the given triangle 90° counter-clockwise about the origin,

The vertex (-1, -1) becomes (1, -1)

The vertex (2, -1) becomes (1, 2)

So, the vertex (2, 3) will be (-3, 2)

∴ The required rotated vertices are  [tex]\left[\begin{array}{ccc}1&1&-3\\-1&2&2\end{array}\right][/tex]

Learn more about rotating triangle here :

https://brainly.com/question/1093215

#SPJ2

FREE PTS! Who is your favorite character? (can be fictional or a real person)​

Answers

Answer:

Yay!!!! Ty for the points!!!!!!!!!!!

I don't have a fav character....I luv BTS - they r real!!!

My mom, she’s a sweetie! So sweet :)

HELP! WILL MARK AS BRAINLIEST (MATHEMATICS FORM 1 // BASIC ALGEBRA) pls help me answer these 4 question TYSM!!!​

Answers

Answer:

hope this help you a lot but it's too late

can you mark me as brainlist

Linda needs 6/9 cup of strawberries and 3/4 cup mashed peach for a recipe. She wants to find whether she needs more peaches or strawberries. How can you write 6/9 and 3/4 as a pair of fractions with a common denominator?

Answers

Answer: Smashed Peach i.e.  [tex]\dfrac{27}{36}[/tex]

Step-by-step explanation:

Given

Linda needs [tex]\frac{6}{9}[/tex] cup of strawberries

and [tex]\frac{3}{4}[/tex] cup of mashed peach for a recipe

For two fractions to have the same denominator, take L.C.M. of the denominator

[tex]\Rightarrow \text{L.C.M.(4,9)}=36[/tex]

[tex]\therefore \dfrac{6}{9}=\dfrac{6\times 4}{36}=\dfrac{24}{36}\\\\\Rightarrow \dfrac{3}{4}=\dfrac{3\times 7}{36}=\dfrac{27}{36}[/tex]

Therefore, she needs more mashed peach for the recipe.

Based on the results shown in the table, how many white marbles would one expect to draw in a total of 50 draws? (hint:set up a proportion)​

Answers

The answer to your question is 10

Patrica has a bank balance of -$54 . if she deposit $100 what is her new Balance

Answers

Answer:

56 (positive, not negative)

Step-by-step explanation:

she will pay off the debt from the original amount she owed using part of the $100. With the debt being payed off , the remainder will be $56.

in other words ;

100+54= 56.

Henceforth , the number 56.

thank you!

PLZ HELP AGAIN DUE TODAY ANSWER CHOICES ARE
A.140
B.188
C.132
D.104

Answers

A) I don’t know for sure but please let me know :)

What are the domain and range of h(x) = 3|x|? A. domain: all real numbers; range: y ≤ 0 B. domain: x ≥ 0; range: all real numbers C. domain: x ≤ 0; range: all real numbers D. domain: all real numbers; range: y ≥ 0

Help! plss

Answers

Answer:

D

Step-by-step explanation:

In the week leading up to Christmas the galaxy shopping center gives away 6700 candy canes to first 83 children visiting the center each child gets same number of candy canes how maby candy canes does each child get round your answer to nearest tenth

Answers

Answer: 80.7

Step-by-step explanation:

From the question, we are informed that in the week leading up to Christmas the galaxy shopping center gives away 6700 candy canes to first 83 children that visits the center and that each child gets same number of candy canes.

If it's shared equally among the children, each child will get:

= 6700 / 83

= 80.7 to the nearest tenth.

increase 140 in the ratio 7:5.​

Answers

Answer:

the answer is 196

Step-by-step explanation:

Answer:

i think that the correct answer might be 196

Jose purchased 105 slices of pizza to sell at his school's fundraiser, yet at the end of the day, he had only sold 58. What is his percent of error?

Answers

Answer:

209 yan ang sagot brainliest po

A cylindrical gasoline storage tank has a diameter of 3.8 ft and a height of 10.9 ft.
What is the total surface area of the tank.

HELP PLZ !!! Extra points will be given !!!

Answers

41.42 u willllll be. Right

Which two consecutive integers does -√138 lie between?
A:11 and 12
B:12 and 13
C:-11 and -12
D:-12 and -13

Answers

Answer:

C:-11 and -12

[tex] - \sqrt{138} \\ = - 11.747 \\ - 11 < x < - 12[/tex]

PLEASE HELP! NO LINKS!!What is the slope of the line in the graph?

Answers

i would say -1/2 not sure though

Someone help me please and no links!!!!! find the value of x

Answers

Answer:

x = 15

Step-by-step explanation:

37*2 = 74

360-74 = 286

286 = 2(9x + 8)

143 = 9x+8

135 = 9x

15 = x

What is the mean of the data set? 17, 24, 26, 13 *
Mark only one oval.
4
13
20

Answers

Answer:20

Step-by-step explanation: 17+24+26+13=80

Divide by how many numbers there are. Answer: 20

Answer:

20

Step-by-step explanation:

Mean = Sum divided by the number of terms

(17+24+26+13)/4

(80)/4 = 20

Mean = 20

What is the answer to this question?

(3+√5)^2

Answers

Answer:

the answer to this is

14 + 6√5

14 + 6√5 because foil method

(3+√5)^2 = (3+√5)(3+√5)

3(3) = 9
3(√5) = 3√5
√5(3) = 3√5
√5(√5) = 5

9 + 3√5 + 3√5 + 5
= 14 + 6√5

5. Amaris buys a car for $12,000. Each year it decreases in
value by 5%. Write an equation to represent the value of the
car after t years.

Answers

Answer:

12,000-(0.05x)=t

Step-by-step explanation:

Marlena has a cube with sides of 5 inches long that she wants to paint. How much paint will it take to cover the cube?
Determine whether this is surface area or volume(Don't need to solve solve, just want a complete sentence explaining your choice).

Answers

Answer: Volume because this is filling something in not covering something up.

Step-by-step explanation:

LOT OF POINTS
approximate the solutions to this system.

y = 3x2 + x − 6

y = x − 4

Round your answers to the nearest hundredth.

Answers

Answer:

[tex] \displaystyle ( x_{1},y_{1}) = (0.82, - 3.18) \\ ( x_{2},y_{2}) = ( - 0.82, - 4.82)[/tex]

Step-by-step explanation:

we are given a system of quadratic and linear equation

we want to figure out x and y

in other words the coordinates where the linear function intercept quadrilateral function

to do so

you can use substitution method

since y equals to both equation so substitute:

[tex] \displaystyle {3x}^{2} + x - 6 = x - 4[/tex]

move right hand side expression to left hand side and change its sign so there's only 0 left on the left hand side:

[tex] \displaystyle {3x}^{2} + x - 6 - x + 4= 0[/tex]

simplify addition:

[tex] \displaystyle {3x}^{2} -2=0[/tex]

add 2 to both sides:

[tex] \displaystyle {3x}^{2} = 2[/tex]

divide both sides by 3

[tex] \displaystyle \frac{ {3x}^{2} }{3} = \frac{2}{3} [/tex]

[tex] \displaystyle {x}^{2} = \frac{2}{3} [/tex]

square root both sides:

[tex] \displaystyle {x} = \sqrt{\frac{2}{3} } \\ x = \frac{ \sqrt{2} }{ \sqrt{3} } [/tex]

rationalise the denominator by multiplying √3/√3:

[tex] \displaystyle x = \pm\frac{ \sqrt{6} }{3} = \pm0.82[/tex]

now let's figure out y

substitute the value of x to the linear equation:

[tex]y = \pm0.82 - 4[/tex]

when positive

[tex]y = - 3.18[/tex]

when negative

[tex]y = - 4.82[/tex]

Answer:

(x1,y1) = (0.82, - 3.18)

(x2,y2) = (-0.82, -4.82)

Step-by-step explanation:

Plato gang

what are the solutions to the expression x^2-8x=24

Answers

Answer: x= 2(2+sqrt(10)) , x=2(2-sqrt(10)

Step-by-step explanation:

x^2-8x=24 <- subtract 24 from both sides

x^2-8x-24 <- take quadratic formulat (-2+/- Sqrt(b^2 - 4ac)/2a

-(-8) +/- sqrt((-8)^2 - 4(1*-24) all over (2*1) <- simplify

(-(-8) +/- 4sqrt(10) )/2 <- sepereate

(-(-8) +/4sqrt(10) )/2 ,  (-(-8) - 4sqrt(10) )/2 <- simplify

2(2+sqrt(10)) , 2(2-sqrt(10) =x

I need quick help. Ill try to give brainliest (since it depends on the amount of people that answer)

Answers

Answer:

The answer should be option B

Alejandra drove from Michigan to Colorado to visit her friend. The speed limit on the highway is 70 miles/hour. If Alejandra’s combined driving time for the trip was 14 hours, how many miles did Alejandra drive?

Answers

Answer:

Alexandra drove 980 miles

Step-by-step explanation:

70×14=980

Un alumno multiplica un número por 32 en lugar de multiplicarlo por 23, obteniendo un producto mayor en 54 al producto original. Halla la suma de cifras del producto original

Answers

Answer:

La suma de cifras del producto original es igual a 12.

Step-by-step explanation:

De acuerdo a la información proporcionada, si multiplicas un número "x" por 32 su resultado sería igual al producto original "y" más 54 dado que dice que se obtiene un producto mayor en 54 al producto original, lo que se puede expresar de la siguiente forma:

32x=y+54

Además, se puede inferir a partir del enunciado que si el número x se hubiera multiplicado por 23 el resultado habría sido el producto original que lo denominamos como "y", por lo que puedes decir que:

y=23x

Ahora puedes reemplazar y=23x en 32x=y+54 y despejar x:

32x=23x+54

32x-23x=54

9x=54

x=54/9

x=6

Finalmente, puedes reemplazar el valor de x en y=23x:

y=23x

y=23*6

y=138

Suma de cifras: 1+3+8 = 12

De acuerdo a esto, la respuesta es que la suma de cifras es igual a 12.

Find the value of y.
120°

Answers

240 I'm pretty sure

cause the whole circle is 360 and the minor arc is 120 so subtract it

how many line segments are needed to connect 20 points in a plane so that each pair of points are the endpoints of a line segment

Answers

i think they all just have it and they all have 30 things in it
Other Questions
What are some of the jobs that geographers have?? What tone is Wordsworth using with this word below (dancing)"Fluttering and dancing in the breeze." Which of the following describes the data set 6,8,13,15,21,23,31 Help please and thatn you plzzzzzzzzzzzzzzzz ill give more points PLZ HELPWhich is the sum of 3.15 10^7 +9.3 10^6 ? Write your answer inscientific notation.A. 4.08 10^7 B. 4.08 10^6 C. 0.408 10^8D. 40.8 10^6 GIVING BRAINIEST Select the expression that represents the following statement: 45 divided by one fifth the product of 3 and 5. (4 points)Group of answer choices45 (3 x 5 x one fifth )(45 one fifth ) x 3 545 ( one fifth x 3 + 5)45 one fifth x 3 x 5 Examine the phases of the moon at the top. The fourth image is replaced by a question mark. Which statement below correctly predicts the next stage of the lunar cycle? When trying to simplify and find the equivalent resistance you should first simplify resistors in _ before simplifying those in _ LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others.