hey I choose America as my national by am not from America, I didn't find my country's name in the list that's why I chose America. who can me to change it? I am a Gambia.​

Answers

Answer 1

Answer:

Ah This is possible. If you want then you can logout your all points , answer and questions post will be lost but you can again choose Gambia and start begginer again.


Related Questions

what side of politics are conservatives on…political left or right?

Answers

Answer:

i think right

Explanation:

Answer:

conservatism and reactionism are generally regarded as being on the right.

Explanation: Hope this helps

a. How did the South react when California joined the United States in
1850? Why did they react this way?

Answers

The South did not take it as well. Why were southerners against California's admission to the Union as a free state? Because they wanted to spread slavery all across the nation. Calhoun wanted slavery in the South. He strongly supported slavery to be allowed anywhere in the nation and for any fugitive slaves to be returned from the North.

Which region's primary economy activity in 1861 was the cultivation of cotton?

Answers

Answer:

The Confederate States of America

Explanation:

(1861-1865) started with an agrarian-based economy that relied heavily on slave-worked plantations for the production of cotton for export to Europe and to the northern US.

What was the Harlem Renaissance?

Answers

Answer:

The answer is below

Explanation

The Harlem Renaissance was widely known for the rise in African American cultural campaigns during the period of the 1920s and early 1930s that is established in the Harlem community of New York City.

Originally known as the New Negro Movement. It involves several artists and social critics in which mediums such as music, dance, art, fashion, literature, theater, and politics were used to express the African American movement.

General Lee’s surrender in 1865 marked
the North’s defeat in the Civil War.
the official end of slavery in the United States.
the South’s defeat in the Civil War.
the end of ten years of armed conflict.

Answers

Answer:

C. The South's defeat in the Civil War

Explanation:

Have a nice day!

Answer:

C

Explanation:

got it right on edge

Which of the following statements about the rebuilding of Japan after World War II is correct?
O A. The emperor was allowed to maintain absolute power in Japan under the new government.
OB. The United States invested in Japan to ensure that communism would not spread to that country.
O c. The Japanese developed their own independent plan for redevelopment after World War II.
OD. The United States invested in Japan but was not concerned about communism spreading to this country.

Answers

Answer:

B

Explanation:

The U.S. wanted to create a strong democracy in the region to combat against communist China

How did Galileo show that gravity is a constant acceleration and not different for each object?
1. He watched pendulums swing and recorded their speed and weight.
2. He shot two arrows straight into the sky and watched them fall.
3. He dropped two objects with different masses from the Tower of Pisa.
4. He rolled hundreds of different balls down the same hill and recorded their speeds.

Answers

Answer:

hm

Explanation:

Answer:

1he watched pendulum swing and

The Nazis controlled Germany's _____________.

Question 8 options:

education


religion


government


all of the above

Answers

Answer:

all of the above

Explanation:

8. Who was Sofonisba Anguissola?

Answers

Answer:

Sofonisba Anguissola, also known as Sophonisba Angussola or Sophonisba Anguisciola, was an Italian Renaissance painter born in Cremona to a relatively poor noble family.

Answer:

Sofonisba Anguissola was an Italian Renaissance Painter.

Which Native American tribe resides in the Northwestern portion of the state?
Navajo. Jicarilla Apache
Cherokee
Mescalero Apache

Answers

Answer:

Jicarilla Apache

Explanation:

There are many tribes that lived in the Northwest region. Some of these were the Chinook, Tillamook, Coast Salish, and the Tlingit. These groups are well known for its hand-crafted totem poles.

Give me the timeline of the Civil War

Answers

Answer:

here

Explanation:

Which of the following explains the most likely purpose of Gonzalo’s answer to the second question in the interview?

Answers

Answer:

To justify the Shining Path’s use of violence to achieve its political objectives.

Explanation:

First, some context: the Shining Path was a revolutionary organization that endorsed employed guerrilla tactics and violent terrorism to overthrow the Peruvian government and establish a communist society.

In the interview, Gonzalo is asked about the people’s war. He discusses two of the aspects of this war. To state it simply, there needs to be change in a government.

This idea is used to promote the Shining Path and “demolish the outmoded Peruvian government.”

To justify the Shining Path’s use of violence to achieve its political objectives the most likely purpose of Gonzalo’s answer to the second question in the interview. Thus, option (c) is correct.

What is interview?

The term interview refers to a formal meeting with the involvement of two people as interviewer and interviewee. The interviewer is one who asks questions and the interviewee is one who answers questions. The conversion is related to the skills, knowledge, and experience related to the job.

Gonzalo’s answer to the second question in the interview was he discuss on the war. Gonzalo’s was they confidently answer the Shining Path’s use of aggression to accomplish its political aims. Shining Path was a revolutionary social group are the violent act of terrorism.

As a result, the significance of the Gonzalo’s answer to the second question in the interview are the aforementioned. Therefore, option (c) is correct.

Learn more about on interview, here:

https://brainly.com/question/13073622

#SPJ6

Your question is incomplete, but most probably the full question was.

Which of the following explains the most likely purpose of Gonzalo's answer to the second question in the interview?

A. To call for the prosecution of those responsible for mass violence in Peru

B. To challenge the continued political influence of Western states in Latin America

C. To justify the Shining Path's use of violence to achieve its political objectives

D. To appeal to politicians in Latin American states to adopt reforms to their respective political institutions

Which of the following is not a belief of John Locke?
a. Every man has personal rights.
b. Governments get their power from the people.
O c. Government has the right to take away all rights of the individual.
O d. People have the right to get rid of a government when it invades the rights of the
individual

Answers

The answer is d just took the quiz

please help i’ll give extra points

Answers

Answer:

President Jackson's response to the Supreme Court's decision was to support Georgia's efforts to remove the Cherokee and vowed to ignore the Supreme Court's ruling. He said, "John Marshall has made his decision. Now let him enforce it."

Explanation:

"We the government should learn to look at our country with the eyes of the
entrepreneur, seeing possibilities where others see only problems. That way,
instead of the unemployed, we'd see a resource of potential workers waiting to
add their labors, their ingenuity (cleverness), their creativity to an expanding
marketplace. And instead of ghettos, we'd see potential enterprise zones, where
increased incentives to work and invest count produce a renaissance [revival) of
business activity and community involvement." - President Ronald Reagan, 1985
Which type of economic system was President Reagan describing?
market
command
O traditional
laissez-faire

Answers

Answer:

Market

Explanation:

Help needed as soon as possible

Answers

Answer:

C

Explanation:

How did the United States gain its independence

Answers

by issuing the declaration of independence

Laissez-faire means that government should interfere as little as possible in the nation's economy is that true or false if you see my questions please respond!

Answers

Answer:

True

Explanation:

Laissez-faire is a policy of minimum governmental interference in the economic affairs of individuals and society.

Why did the United States choose to fight communism abroad?

Answers

Answer:

Explust as the U.S. government feared the possibility of Communist infiltration of the United States, so too was it alert for signs that Communist forces were on the move elsewhere. The Soviet Union had been granted control of the northern half of the Korean peninsula at the end of World War II, and the United States had control of the southern portion. The Soviets displayed little interest in extending its power into South Korea,anation:

Which of these BEST describes the political structure of Ancient Egypt? a theocracy B) matriarchal society constitutional monarchy republican form of government​

Answers

Answer:

ik

Explanation:

Answer:

a - theocracy

Explanation:

the other provided answers don't fit

what state does japan compare in size in regards to landmass

Answers

Answer:

Size comparison Japan is around the same size as California. California is approximately 403,882 sq km, while Japan is approximately 377,915 sq km, making Japan 93.57% the size of California. Meanwhile, the population of California is ~37.3 million people (88.3 million more people live in Japan).

Explanation:

Answer:

california

Explanation:

A non-traditional family is one in which:

the mother works and the father stays home.

the parents had their children at age 40 or over.

there is an arrangement other than two parents with one or more children.

None of these choices are correct.

Answers

Answer:

the first one

Explanation:

a non-traditional the mother would work and the father wouldnt.

What decision by Ottoman rulers angered ethnic Turks?

Answers

Answer:The Ottoman system was generally tolerant of non-Muslims, who made up a significant minority within the empire. Non-Muslims paid a tax, but they were allowed to practice their religion or convert to Islam.

Explanation:

43.
Which individual is most closely associated with creating a steel monopoly?
O Gifford Pinchot
O Andrew Carnegie
O John D. Rockefeller
O Samuel Gompers

Answers

Answer:

B - Andrew Carnegie

Explanation:

Andrew Carnegie went a long way in creating a monopoly in the steel industry when J.P. Morgan bought his steel company and melded it into U.S. Steel. Eventually, U.S. Steel stagnated in innovation as smaller companies ate more and more of its market share.

Describe a private judge

Answers

Explanation:

Private judging is a process where the disputing parties agree to retain a neutral person as a private judge. The private judge, who is often a former judge with expertise in the area of the dispute, hears the case and makes a decision in a manner similar to a judge.

Should the government have stepped in during the Great Depression ?

Answers

Answer: Mabey

Explanation:After 1929, the federal government's economic role increased substantially. ... The federal government under President Herbert Hoover moved promptly to try to deal with the Depression. Hoover pressed employers not to reduce wages, and he increased federal funding for public works projects.

Answer:

Yes

Explanation:

During that time they could of done so much such as mandatory price drops or similar thing to the stimulus package we have now that the Gov always had as a back up plan for disasters

Presidential electors were chosen to represent the interests of their _____.

Answers

Answer:

States.

Explanation:

Who was Muhammad's friend and father-in-law and the first leader of Islam after Muhammad's death?


Ibn Sina


Umar


Al-Khwarizmi


Abu Bakr

Answers

Answer:

Abu Bakr

Explanation:

He was the next leader of Islam after Mohammad's death.

Answer:

Abu Bakr

Explanation:

Yes

three ways in which the soweto protesters harmed their community in their attempt to be public participants​

Answers

Answer:

The Soweto uprising was a series of demonstrations and protests led by black school children in South Africa that began on the morning of 16 June 1976.[1]

Students from numerous Sowetan schools began to protest in the streets of Soweto in response to the introduction of Afrikaans as the medium of instruction in local schools.[2] It is estimated that 20,000 students took part in the protests. They were met with fierce police brutality and many were shot and killed. The number of people killed in the uprising is usually given as 176, but estimates of up to 700 have been made.[3][4][5] In remembrance of these events, 16 June is now a public holiday in South Africa, named Youth Day.[6]

Explanation:

hope this helps :)

Soweto protesters were on the street of Soweto due to the government introducing the Afrikaans language to be used as a medium of instruction in local schools.

What was the impact of the Soweto protest?

The Soweto movement was led by the school students in South Africa in 1976. They all were protesting against the government's order around 20000 students gathered on the street in Soweto city.

Because college students believed that they deserved to be dealt with and taught like white South African. There had been few those who spoke Afrikaans as a medium of language. It caused 575 deaths and 451 arrests through the police.

Therefore Soweto protesters harmed their community.

Learn more about The Soweto protest here:

brainly.com/question/3924797

Were the bloodthirsty invaders ?

Answers

Answer:

Yes they were

Explanation:

yes , hope this helps lols
Other Questions
LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s.