2 1/4 + 3 1/2 = ??? ​

Answers

Answer 1

Answer:

[tex]5\frac{3}{4}[/tex]

Step-by-step explanation:

You need to set bot denominators equal so multiply the second fraction by two for both the top and bottom.

[tex]2\frac{1}{4} +3\frac{1}{2} \\ =2\frac{1}{4} +3\frac{2}{4}\\\\ =5\frac{3}{4}[/tex]


Related Questions

Write the equation 2x+3y=1470 in function notation. (Be sure to create a graph and place it in your answer.) Explain what the graph of the function represents. Be sure to use complete sentences.

Answers

2x + 3y = 1470

3y = -2x + 1470

y = -2/3 + 490

There are 12 brown hair teachers and 20 blond hair teachers. For every blank blond teachers there are blank brown teachers

Answers

Answer:

For every 5 blonde teachers there are 3 brown teachers.

Step-by-step explanation:

Here we have to find the ratio of blonde teachers to brown teachers

Blonde : Brown

20: 12

10:6

5:3

For every 5 blonde teachers there are 3 brown teachers.

This can be further evaluated

Blonde : Brown

5:3

dividing both sides by 5

1: 3/5

For every 1 blonde teachers there are 3/5 brown teachers. It means that the brown teachers are 2/5 less than the blonde teachers.

1-2/5= 3/5

20* 3/5= 12

my teacher gave the answer but I have to figure out how she got the answer please help. ​

Answers

Answer:

what i did was 360 and how i got that was a circle equals 360 so 360-108=252 so 360-252=108

Step-by-step explanation:

Answer:

∠ABC= 70

Step-by-step explanation:

arc AB = 110, so ∠ACB = 55,

ΔABC is an isosceles triangle cause two sides are the same,

so ∠BAC = 55, angles in a triangle adds up to 180, so

180 - 55 - 55 = 70 =  ∠ABC

How do I solve 3x-5>0 ? Can someone explain please​

Answers

Answer:

Find my Answer attached.

Step-by-step explanation:

9514 1404 393

Answer:

   x > 5/3

Step-by-step explanation:

In general, inequalities are solved the same way that equations are: undo what is done to the variable. (Whatever you do to one side of the inequality, you must also do to the other side.)

If you were to evaluate this inequality for some value of x, you would ...

multiply by 3subtract 5

When solving for x, you undo these operations in reverse order. You undo the "subtract 5" by doing "add 5" to both sides of the inequality:

  3x -5 +5 > 0 +5

  3x > 5

You undo the "multiply by 3" by doing "divide by 3" to both sides of the inequality:

  (3x)/3 > 5/3

  x > 5/3 . . . . . . . the solution

__

Additional comment

The only difference between solving an equation and solving an inequality is that multiplication or division by a negative number reverses the comparison symbol.

Consider -1 > -2. When this is multiplied by -1, it becomes 1 < 2, with the comparison reversed.

__

As you can see, as long as multiplication and division are with positive numbers, the actual comparison symbol doesn't matter:

  3x -5 > 0   ⇒   x > 5/3

  3x -5 = 0   ⇒   x = 5/3

  3x -5 < 0   ⇒   x < 5/3

Find the mean, median, and mode(s) of the data. Do not round.

12, 13, 40, 95, 88, 7, 95

Answers

Mean:350
Median:95
Mode:95

Answer:

i know the mode is 95

Step-by-step explanation:

HELPPP ME PLEASE!!!
(don’t answer if you don’t know or just for points bc i’ll report)

Answers

Answer:

The last one

Step-by-step explanation:

Find the missing side. Round to the nearest tenth.

Answers

150 is your answer,hope it helped

Like what that guy said sorry did not mean to disturb

HELP!!!! i’m really confused and it’s due today

Answers

Answer:

I think H because it is the only one going vertical

Step-by-step explanation:

If you help I swear to god I will give brainliest!

Answers

Answer:

a. 45 b. 44  c. 30  d. 50 and e. 65

Step-by-step explanation:

divide. when you divide a fraction, flip it.  ex. 22 ÷ 1/2 would be 22× 2/1

Answer:

the first one is the answer is 45 miles , because 135 miles divided by 3 hours [180 minutes] equals to 0.75 , 180 minutes times 0.75 equals to 135 miles , 2 hours [120 minutes] times 0.75 equals to 90 miles and 1 hour [60minutes] times 0.75 equals to 45 miles.

Step-by-step explanation:

b. 44  c. 30  d. 50 and e. 65

16.6 repeating %
a.⅙

b.⅓

c.⅗

d.⅔

Answers

the answer is a which is 1/6

Answer:

Step-by-step explanation:

a. 1/6 because 16.6% is 0.166666666666

1/6 = 0.166666666666

The image of the point (2, -3) under a translation is (-1, 1). Find the coordinates of the image of the point (5, 6) under the same translation.

Answers

Answer:

the anser is b great job

Step-by-step explanation:

A store buys a coat for $120. If they sell it for $180, why is the percent of change?

Answers

Answer: 50%

Step-by-step explanation: [tex]180 - 120 = 60[/tex], [tex]60/120=1/2[/tex] which is [tex]50%[/tex]%.

Hope this helps!

role 2 dice with number 1 through 6 and add them together this sum is recorded as the outcome of a single trial of a random experiment

I just need to fine the (the sum is divisible by 3)

please make it fast thank you​

Answers

Answer:

porrrrnyyyyu???

Step-by-step explanation:

Elaine has a $25 gift card. She uses the card each
month to purchase a magazine for $3.50 at the
bookstore. How much money will Elaine have
remaining on her gift card after 7 months?

Answers

Answer:

$0.50

Step-by-step explanation:

multiply 3.50 by 7 and you get 24.5. $25.00-$24.50= $0.50

Answer:

0.5

Step-by-step explanation:

Well lets start with a basic equation.

$25=3.50(7)

25= 24.5 multiply 3.50 and 7

25-24.5=0.5 subtract the total from the whole

After using the card for 7 months she will have 5 cents left on her card.

What is the slope of the line shown below?

Answers

Answer:

2

Step-by-step explanation:

ΔX = -1 – 2 = -3

ΔY = -4 – 2 = -6

-6 divided by -3=2

Hope it helps ;)

Step-by-step explanation:

[tex]slope = \frac{y2 -y1 }{x2 - x1} \\ = \frac{ - 4 - 2}{ - 1 - 2} \\ = \frac{ - 6}{ - 3} \\ = 2[/tex]

even if x₁ = -1, y₁ = -4 and x₂ = 2, y₂= 2 the result remains the same.

#CMIIW

The dot plots show rainfall totals for several spring storms in highland areas and lowland areas. What is the median rainfall for the highland storms? What is the median rainfall for the lowland storms?

Answers

Answer:

Median highland = 16 mm

Median lowland = 16 mm

Step-by-step explanation:

For the highland area :

The sample size, n = 44

Obtain the median value using :

1/2 * (n + 1)th term

1/2 * (44 +1) th term

1/2 * 45 = 22.5th term.

(22nd + 23rd) term / 2

(16 + 16) / 2 = 16 mm

For the lowland area :

1/2 * (n + 1)th term

1/2 * (44 +1) th term

1/2 * 45 = 22.5th term.

(22nd + 23rd) term / 2

(12 + 12) / 2 = 12 mm

Answer:

16mm, 12mm

Step-by-step explanation:

on edge got it right

Can some show the steps and the answer please I really need help tell me how you get it and the answer

Answers

Answer:

if you use the 10 feet ladder base is 6 feet

if you use 12 feet ladder base is 8.94 feet

if you use 15 feet ladder base is 12.69 feet

Step-by-step explanation:

you know the ladder length so you know the hypotenuse

you can use a^2 + b^2= c^2

for example you use the 10 feet ladder

8^2+b^2 = 10^2

64 + b^2 = 100

subtract 64 from both sides

b^2=36

to get rid of the exponent find square root

b= 6

you can plug in the different values like 15 or 12

Please please help me I will give brainileist

Answers

Answer:

26

Step-by-step explanation:

Average = all the numbers added together then divided by the amount of numbers in the equation

21+24+25+25+26+26+26+26+27+29= 255

Since there are ten numbers in this equation, divide the sum by 10

25.5

round up

26


The equation g=3r represents how much Trevin makes per hour at his job. What is the unit rate?​

Answers

Answer:

Hope It Help

Brainliest please

Answer:

3

Step-by-step explanation:

The unit rate is a rate with 1 in the denominator. The unit rate for this equation would be how much money he makes in one hour. So, to find the unit rate plugin 1 for r and solve for g. One times three (1*3) is equal to 3; therefore, that is the unit rate.

Coach Miguel bought 3 identical soccer balls for his soccer team. After applying a $25.00 store gift card, his total was $13.97. Which equation can be used to calculate by the price of each soccer ball?
A 3b - 25 = 13.97
B. 3b + 25 = 13.97
C. 1/3b - 25 – 13.97
D. 1/3b + 25 = 13.97​

Answers

Answer:

F the person that Post the question

Step-by-step explanation:

He said he couldn’t give me the answer because we went to different schools like who does that

What is the 95% confidence level for students who are planning to vote for Talia as president of the club?

C = + E

Answers

members which will vote for Talia as president of the club lies between minimum of 33 members and maximum of 42 members.

Answer:

C=+E

Step-by-step explanation:

mm

Evaluate the function below for x=2 f(x)=x^4+6x^3+3

Answers

Answer:

f(2)=67

Step-by-step explanation:

In order to evaluate the function you must switch all of the x for 2

so it would be f(2)=2^4+6(2)^3+3

GUYSSS PLS HELP ME IM GONNA FAIL FRR

Answers

Answer:

x = 11

Step-by-step explanation:

180 - (82+50)

180 - 132

48

5x-7 = 48

5x = 55

x = 11

(4) please try and find the area of a triangle thank you

Answers

Answer:

The answer is 6m

Step-by-step explanation:

This is because the formulae used to find the area of a triangle is ½ multiplied by the base multiplied by the height.

Hope it helps:)

Does someone understand this

Answers

Answer: 61

Step-by-step explanation:

You should break the figure into separate shapes, find the area, and add them together.

The two lines graphed on the coordinate grid each represent an
equation.
7.
6
5
4
2
6514
2
1
3
-
Which ordered pair represents a solution to both equations?
A.
(-4, 3)
B. (-3,-4)
C. (-4,-3)
D. (4, -3)
Need

Answers

9514 1404 393

Answer:

  C.  (-4, -3)

Step-by-step explanation:

The point where the lines cross is the solution to both equations. That point is in the third quadrant, where both coordinate values are negative.

The x-coordinate of the point is listed first, so the solution is ...

  (x, y) = (-4, -3)

Can some one please help me with thins i cant figure the answer out ill will give 25 points for help.

6n=39

Answers

Answer: 6.5

Step-by-step explanation:

Divide 39 by 6.

39/6= 6.5

Divide both sides of the equation by the same term

6n=39

Divide 39 by 6

N= 13/2

The area of a rectangular painting is 8811 cm^(2). If the length of the painting is 99 cm , what is its width?

Answers

Answer:

The answer is 784,179.

Step-by-step explanation:

8811 x 8811, or 8811*2 is 77633721.

77633721 / 99 = 784,179

A tray can hold 9 milk bottles. There are 9063 milk bottles in a dairy farm. After packing the milk bottles in the trays,10 trays are left empty. How many trays are there in total in the farm?

Answers

Answer:

1017

Step-by-step explanation:

9063/9=1007

1007+10=1017

Myrna is bought fresh flowers for her Mom’s birthday. She had $25 with her. The flowers were on a 10% sale. How much did Myrna pay for the flowers?

Answers

Answer:

2 [tex]\frac{5}{2}[/tex]

Step-by-step explanation:

[tex]\frac{25}{1} \\[/tex] × [tex]\frac{10}{100}[/tex] =  [tex]\frac{10}{4}[/tex] or

Simplified: [tex]\frac{5}{2}[/tex]

2 whole number [tex]\frac{1}{2}[/tex]

Other Questions
What are some of the jobs that geographers have?? What tone is Wordsworth using with this word below (dancing)"Fluttering and dancing in the breeze." Which of the following describes the data set 6,8,13,15,21,23,31 Help please and thatn you plzzzzzzzzzzzzzzzz ill give more points PLZ HELPWhich is the sum of 3.15 10^7 +9.3 10^6 ? Write your answer inscientific notation.A. 4.08 10^7 B. 4.08 10^6 C. 0.408 10^8D. 40.8 10^6 GIVING BRAINIEST Select the expression that represents the following statement: 45 divided by one fifth the product of 3 and 5. (4 points)Group of answer choices45 (3 x 5 x one fifth )(45 one fifth ) x 3 545 ( one fifth x 3 + 5)45 one fifth x 3 x 5 Examine the phases of the moon at the top. The fourth image is replaced by a question mark. Which statement below correctly predicts the next stage of the lunar cycle? When trying to simplify and find the equivalent resistance you should first simplify resistors in _ before simplifying those in _ LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others.