Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.

Answers

Answer 1
Natural selection is the survival of the fittest. Basically the organisms that best suit the environment they’re in will survive, and the less suited will pass. Artificial selection is when humans intervene and breed plants and animals to have desired traits. Like if one turtle has a longer neck than the other, and the plants are really tall in an area, people might selectively breed them so less turtles are dying of hunger.

Related Questions

what makes a thing non living?

Answers

Answer:

which does not breath

Explanation:

Strands of genetic material floating in the nucleus are refered to as_____

Answers

They are refered to as DNA.
Also knows as Deoxyribonucleic Acid

Lab: Natural Selection
Claim Evidence Reasoning - Natural Selection Lab
Active
Prompt
If Mt. Kaboob were to erupt again, what changes might you expect to see in the walking bean population?

Answers

Answer:

It would increase.

Explanation:

All 37 trillion cells in the human body came from?

Answers

Answer:

all 37 trillion cell in the body originates from a single fertilized egg called a zygote. The zygote divides repeatedly to produce an embryo. These embryonic cells continue to divide, differentiating into all the cell types present in the body of all humans (and other mammals), from a new-born baby to an elderly adult.

Which of the following causes the change in seasons on Earth?
A.
the spinning of the Earth on its axis, and the Earth revolving around the Sun
B.
the Earth revolving around the Sun, and the moon revolving around the Earth
C.
the tilting of the Earth on its axis, and the Earth revolving around the Sun
D.
the tilting of the Earth on its axis, and the sun revolving around the Earth

Answers

Answer:

the answer is c

Explanation:

I learned it befo3

C.

I learned this as well before

What are the functions of the digestive system?

Answers

Answer:

The function of the digestive system is digestion and absorption.

Explanation:

Digestion is the breakdown of food into small molecules, which are then absorbed into the body.

If a myostatin protein is not the right shape, it cannot fit correctly into a cells receptor true or false

Answers

This answer would be false

Explanation: Myostatin (also known as growth differentiation factor 8, abbreviated GDF8) is a myokine, a protein produced and released by myocytes that acts on muscle cells to inhibit muscle cell growth. In humans it is encoded by the MSTN gene.[6] Myostatin is a secreted growth differentiation factor that is a member of the TGF beta protein family.[7][8]

Therefore, if the myostatin protein is smaller than a microorganism it would be able to fit into the receptor.

Also, it helps me out if I get brainliest because it makes me a higher rank


The series of membrane-bound channels between the nuclear and
cell membranes, serving as a cellular transport system is the
o plasma membrane
O nucleus
o endoplasmic reticulum

Answers

Answer:

C. Endoplasmic Reticulum.

Explanation:

The Endoplasmic Reticulum also includes ribosomes attached to the membrane and can produce protein.

I hope this helps you! :)

5 Erosion and deposition are often discussed
together. Which statement most accu-
rately describes their difference?
A Erosion wears material away, and
deposition moves the material.
B Erosion moves weathered material, and
deposition resettles it.
C Erosion wears material away, and
deposition resettles it.
D Erosion and deposition are not
different; both describe moving
weathered material.

Answers

Answer:

Erosion wears material away, and

deposition resettles it.

In the presence of oxygen, _____ molecules of ATP can be formed during cellular respiration.

A. 36 to 38
B. 19 to 24
C. 2 to 4
D. 63 to 68
E. 38 to 42

Answers

the answer is A. 36 to 38. hope i helped!!

The question below is an incomplete sentence. Choose the word that best completes the sentence.
Antlered flies are tiny insects that live in the tropical forests New Guinea.
of
and
or
for

Answers

Answer:

of

Explanation:

makes grammatical sense

Answer is of because it is best fit

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

Please help, any unnecessary answers will be reported. Thanks :)

Answers

it's c

Explanation:

because there's different types of cold and illnesses so there can be different symptoms each time

Explain, using complete sentences, the trend in levels of blood glucose from 11:00 a.m. to 10:00 p.m.
In your answer use the following terms:
[Feedback mechanism] [stimulus] [response] [positive or negative]

Answers

Answer:insulin and glucose

How do actin and myosin work together to move a muscle?

Answers

Answer:

I don't know

Kwoeieu3iejdhd

3 examples of radioactive dating?

Answers

Answer:

Uranium 238

Potassium 40

Rubidium 87

Explanation:

Which type of selection leads to increased phenotypic and genetic variation?
directional selection
disruptive selection
stabilizing selection
species selection

Answers

Answer:

stabilizing selection

please fill out! desperately need very soon!!!!!!!!!!!!!!!!!!!

Answers

Answer:

nxm ZQM

Explanation:

XM AM

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

sce
iding Page
Links
The world's coasts are being urbanized at a very rapid rate. It is estimated that more than
half of today's world population live in coastal areas and this number continues to rise.
Coastal areas are also the most visited by tourists across the globe. Which of the following
threats to the ocean is most likely NOT posed by human actions?
ince Syllabus 2020.doc
ence
ve your OneNote
Your answer:
Project
ket 04/14
tion in the Atmosphere
O Pollution of marine resources
O Damaged coral reefs
Higher hurricane wind speed
O Damaged sea turtle nesting sites
CIAS
11:21 AM
4/14/2021
mo

Answers

Answer:

Higher hurricane wind speed

name one disorder of the digestive system​

Answers

Answer:

Stomach Flu

Explanation:

Stomach flu—or gastroenteritis—is an infection of the stomach and upper part of the small intestine. Common symptoms are diarrhea, vomiting, stomach pain, and cramps. Rotavirus and norovirus, which affect millions of people every year, are often the cause. Gastroenteritis often clears up on its own, but you lose fluids through diarrhea and vomiting. Prevent dehydration by drinking water and electrolyte drinks.

How do the posterior pituitary gland and the anterior pituitary gland differ in structure ?

Answers

The anterior pituitary receives signalling molecules from the hypothalamus, and in response, synthesizes and secretes seven hormones. The posterior pituitary does not produce any hormones of its own; instead, it stores and secretes two hormones made in the hypothalamus.

Answer:

they differ like

Explanation:

The anterior pituitary receives signalling molecules from the hypothalamus, and in response, synthesizes and secretes seven hormones. The posterior pituitary does not produce any hormones of its own; instead, it stores and secretes two hormones made in the hypothalamus.

Oxygen, Sunlight, and temperature are all examples of what type of limiting factor?

Answers

Answer:

Biotic Limiting Factors

These limiting factors can be further broken down into abiotic or biotic limiting factors. Abiotic factors are non-living physical and chemical elements in the ecosystem, such as sunlight, temperature, soil, water, and oxygen

Which of the following descriptions is MOST plausible for an ancestor of bats? An animal with-
A: two limbs and webbed toes.
B: a long tail that ate insects and lived in forests.
C: four limbs and a membrane consistent with gliding.
D: four fins that glided through the water.

Answers

Answer:

C

Explanation:

Four limbs and a membrane consistent with gliding are the structures found in ancestors of bats. Therefore, option (C) is correct

What is patagium?

A membrane called the patagium helps animals glide or fly. Bats, birds, dromaeosaurs, pterosaurs, gliding mammals, flying lizards, and flying frogs have the structure. The uropatagium (particularly in bats) or interfemoral membrane connects an animal's hind limbs.

Bats' wing skin extends from the abdomen to the tip of each digit, connecting the forelimb to the body. Bat patagiums have four parts:

Propatagium: neck-to-first-digit patagium.Dactylopatagium: digits.Plagiopatagium: between final digit and hindlimbs.Uropatagium: posterior flap between hindlimbs.

Therefore, option (C) is correct.

Learn more about Bats, here:

https://brainly.com/question/3406200

#SPJ2

helpppppppppppppppppp

Answers

I’ve tired I’m sorry I don’t know

How can a change in genotype affect the phenotype?

Answers

Answer:

The genome in which a genotype is found can affect the expression of that genotype, and the environment can affect the phenotype. Genes can also be pleitropic when they affect more than one trait. The single base pair mutation that lead to sickle cell anemia is a classic example.

Answer: population

Explanation: An organism's genotype is the set of genes that it carries. ... However, since an organism's genotype generally affects its phenotype, the phenotypes that make up the population are also likely to change. For example, differences in the genotypes can produce different phenotypes.

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Explain how biotechnology has used the idea of ‘cut and paste’ when it comes to biotechnology *not multiple choice question*

Answers

Answer:

Biotechnology, the use of biology to solve problems and make useful products. The most prominent area of biotechnology is the production of therapeutic proteins and other drugs through genetic engineering. ˗ˏˋ ❤︎ ࿐

Explanation:

4. Write the complementary DNA strand for the given strand of DNA.
a. CATAAGCACTTAGGC -
b. CCAGAGTAGCCAGGT-
help plss​ huhuhu i need answer

Answers

Answer: A. GTATTCGTGAATCCG

B: GGTCTCATCGGTCCA

Explanation:

G goes with C and A goes with T

Remember with a song:

Apples go in trees, Cars in the garage

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

Other Questions
the winner of a raffle will receive a 21-foot outboard boat. if 2000 raffle tickets were sold and you purchased 50 tickets, what are the odds against your winning boat? Que es una campaa?, que proposito puede tener?, porque medios se puede tranmitir?, que recursos del lenguaje se pueden utilizar en ella? help in pic eeeeeeee Use Trig to Solve this...If you dont know how to use trig in right triangles then DONT answer. A steel bottle contains nitrogen gas at STP. What is the final pressure if the temperature is changed to 155C? Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you!