Will award 100 points!! Are these answers correct?

Will Award 100 Points!! Are These Answers Correct?

Answers

Answer 1

Answer:

Yes these answers are correct

Explanation:

I hope you did well on the test :)

Answer 2

Answer:

yes

Explanation:


Related Questions

subject is science

Please help me with this

Answers

Answer:

1st is form a hypothesis. that's all I know. Sorry.

Explanation:

Digest the sequences using Haelll. Person 1 GGCCTCGGCCTAGAACGGCCTAGCCG CCGGAGCCGGATCTTGCCGGATCGGC Person 2 CTGAGGCCTAAGCGATTCCCGGATATA GACTCCGGATTCGCTAAGGGCCTATAT

Answers

Answer:

Nucleotide fragments of the sequence 1:

1. CCTAGCCGCCGGAGCCGGATCTTGCCGGATCGGC (base 19 to base 52)

2. CCTAGAACGG (base 9 to base 18)

3. CCTCGG (base 3 to base 8)

4. GG (base 1 to base 2)

Nucleotide fragments of the sequence 2:

1. CCTAAGCGATTCCCGGATATAGACTCCGGATTCGCTAAGGG (base 7 to base 47)

2. CCTATAT (base 48 to base 54)

3. CTGAGG (base 1 to base 6)

Explanation:

HaeIII is a restriction enzyme isolated from Haemophilus aegyptius bacteria, which is widely used in molecular biology laboratories. This enzyme is an endonuclease, i.e., it cleaves phosphodiester bonds within a polynucleotide chain. HaeIII is a restriction enzyme that cleaves DNA at the recognition sequence 5′-GG/CC-3'.

Yes, i'm at it again. Help please, thank yous :'D
1. Why would cells in some organs be consuming more oxygen than cells in other organs?

Answers

Answer:

Answer is below:

Explanation:

As oxygen molecules diffuse into the cell, they are consumed. But interstitial fluid volume is only a little more than half the intracellular fluid volume. The circulating blood must be brought close to the cells since the systemic organs (tissues) are connected in parallel.

Hope this helps!

Which feature is most likely found at a divergent boundary?

fold
plateau
fault-block mountain
anticline or syncline

Answers

Coming off my lab report in science. The only one that would probably be in a divergent boundary is a fold because most divergent boundary’s have earthquakes

Fault-block mountain is most likely found at a divergent boundary, the correct option is C.

What is a divergent boundary?

When 2 tectonic plates move apart from one another, they form a divergent boundary.

Earthquakes are ubiquitous along these boundaries, and magma rises from the Earth's mantle to the surface, solidifying to form new oceanic crust.

Fault-block Mountains are usually form at the divergent boundaries.

Thus, the correct option is C.

For more details regarding divergent boundaries, visit:

https://brainly.com/question/16660809

#SPJ5

What effect do glaciers have on plant life?
Glaciers bring quantities of minerals that choke plant life as the water runs off melting ice.
Glaciers has no effect on plant life other than helping distribute necessary water.
Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.
Glacial flooding is destructive to plant life as silt builds in rivers.

Answers

Answer:

CORRECT ANSWER IS Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.

Explanation:

The effects that, glaciers have on plant life is glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice. The correct option is c.

What are glaciers?

A glacier is a sizable, enduring mass of crystalline ice, snow, rock, silt, and frequently liquid water that forms on land and slides down a slope due to gravity and its own weight. There is melting ice due to global warming.

When glaciers continued to move across Minnesota's landscape thousands of years ago, these lakes were created. When glaciers carved up holes in the earth, ice chunks dropped into them and eventually melted, creating lakes.

Therefore, the correct option is c. Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.

To learn more about glaciers, refer to the link:

https://brainly.com/question/20756979

#SPJ2

what are steroids. ?

Answers

steroids, also known more properly as anabolic–androgenic steroids, are steroidal androgens that include natural androgens like testosterone as well as synthetic androgens that are structurally related and have similar effects to testosterone.

Explanation:

Answer:

its any of a large class of organic compounds with a characteristic molecular structure containing four rings of carbon atoms (three six-membered and one five). They contain things such as testosterone and they are normally used as drugs to build up muscles in the body.

Explanation:

hope this helps :))

PLEASE HELP ME ASAP, THIS IS DUE TODAY AT 4:00!!



Which term refers to the structure that forms the surface of a cell, separating its contents from the outside world?

Question 6 options:

mitochondria


endoplasmic reticulum


plasma membrane


capsule

Answers

Answer:

Endoplasmic reticulum

Explanation:

Answer:

Its plasma membrane

Explanation:

:)

PLEASE HELP 50 POINTS. In Newton's cannonball illustration, what happens if the cannon ball's velocity is slightly faster than the circular orbit speed?
A. the cannon ball will crash into space B. the cannon ball will break orbit and go off into space. C. The cannon ball will have an elliptical orbit

Answers

The option that happens if the cannon ball's velocity is slightly faster than the circular orbit speed is option C: The cannon ball will have an elliptical orbit.

What is the  Newton's cannonball illustration about?

The  Newton's cannonball illustration states that when a given ball is said to have gone or travels a little more faster than that of the circular velocity, it will create a kind of an elliptical orbit with the cannon and this is done at the perigee which is said to be the closest point in the orbit.

Note also that If the ball is said to have travels at the escape velocity, the orbit will be tend to open.

Therefore, The option that happens if the cannon ball's velocity is slightly faster than the circular orbit speed is option C: The cannon ball will have an elliptical orbit  is correct.

Learn more about circular orbit from

https://brainly.com/question/18496962

#SPJ1

10. Which protist kills more people on earth every year?

Asap

Answers

Answer:

Malaria

Explanation:

In fact, malaria is one of the most common infectious diseases on the planet. Malaria is also a very serious disease. It kills several million people each year, most of them children

Which events are likely to be catastrophic to an ecosystem? Select the two
correct answers.
O A. Massive flooding
O B. Steady population growth
O C. Introduction of an unchecked invasive species
D. Spring thunderstorm
O E. Species competition

Answers

Answer:

A and C

Explanation:

Steady population growth, spring thunderstorms, and species competing with each other are not bad for the ecosystem.

But when a massive flood happens it can be devastating and destroy very large parts of the land. Also if we introduce an invasive species that becomes unchecked it can destroy a food supply. If the species has no predator that would thin the numbers it can be truly devastating to an ecosystem.

What cell would pass on to an offspring

Answers

Answer:

the answer is prokaryotes

somatic cells —————————

2. During incomplete dominance, a heterozygote will show
A) blending of traits;
C) only the dominant trait
B) both traits present separately
D) one of the two traits randomly

Answers

Answer:

both traits present separately

What cellular process is occurring in the organelle labeled A? DS
5 Points)
udents constructed a diagram to represent two related cellular processes.
ATP
ooooo
B
F. Photosynthesis
G. Cellular respiration
H. DNA replication
J. Protein synthesis

Answers

Answer:

Photosynthesis

Explanation:the chloroplast is taking in sunlight

Part A: In the Nitrogen Cycle, how does unusable atmospheric nitrogen become usable in the soil?
Part B: In the Carbon Cycle, how do humans influence the greenhouse affect?

Answers

Explanation:

Part A:

The atmospheric nitrogen (N2) is transfered into Amoniom ion (NH4+) by a special bacteria which lives in soil. This process is called Nitrogen fixation. The Amoniom ion is absorbed by plant.

Part B:

When human is breathing CO2 (Carbon dioxide) is coming out to air. CO2 is one of the gasses that has a big influence on green house affect.

Besides، burning fossil fuels by humans is also another example of human effects on green house affect.

Other gasses that have influence on greenhouse affect are:H2O(water) CO2(carbon dioxide) CH4(methane)

example of asexual reproductionexample of asexual reproduction in plants ​

Answers

Answer:

Plants have two main types of asexual reproduction: vegetative reproduction and apomixis. ... Bulbs, such as a scaly bulb in lilies and a tunicate bulb in daffodils, are other common examples of this type of reproduction. A potato is a stem tuber, while parsnip propagates from a taproot.

Explanation:

Where do green plants obtain the following for food production?
• Water -
• Carbon (iv) oxide
• Enzymes
• Sunlight
• Chlorophyll

Answers

Answer:

sunlight and chlorophyll

the sun produces the energy which the chlorophyll catches to convert to chemical energy and food it also gives the plant a green color a plant may also use this for photosynthesis and other reactions.

Explanation:

Answer:

Green plants get Water and minerals from the soil.Carbon dioxide is available in air so plant get carbon dioxide easily.Enzymes are found in chloroplasts of plant cells which are involved in chemical reaction of photosynthesis.Sunlight is obtained directly from the sun during day time.Chlorophyll is available in the plant.

ANSWER ASAP will make u brainliest!!

Answers

Option 3.......
subatomic particles, atoms, molecules, organelles, cells, tissues, organs, organ systems, organisms and biosphere

Answer:

not sure

Explanation:

b . plz don't get mad if I choose the wrong answer

Where does translation occur?

Answers

ribosomes

Explanation:

Why is Pluto known as dwarf planet? Pluto is considered as dwarf planet because it has not clearedtge neighborhood around its orbit. It orbits in a disc-like zone beyond the orbit of Neptune called the Kuiper belt, a distant region populated with frozen bodies left over from the solar systems' formation.

Answers

Answer:

Pluto is known as dwarf planet because it has not cleared the neighborhood around its orbit

Explanation:

Pluto is not considered a planet any more and it is called a dwarf planet because it does not meet one of the international astronomical Union criteria which is " it has not cleared it's neighbouring region of other object" which indicate that it has no gravitational dorminancy and it's tend to share it's orbital space with other neighbouring objects of the same size.

Pluto has mountains, glaciers and thin atmosphere.

The sequence of nitrogenous bases in DNA varies widely. The sequence of the bases in DNA is most important for which of the following?

Answers

Answer: I'm not sure what the choices are, but the answer would be the coding for amino acids/genes/traits. See if you can find something along those lines. Let me know if you need a little more help :)

The sequence of nitrogenous bases in DNA varies widely. The sequence of the bases in DNA is most important for translation.

What do you mean by translation?

In molecular biology and genetics, translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus.

DNA translation is the term used to describe the process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum. The genetic information in DNA is used as a basis to create messenger RNA (mRNA) by transcription.

Translation takes place on ribosomes in the cell cytoplasm, where mRNA is read and translated into the string of amino acid chains that make up the synthesized protein.

Learn more about translation:

https://brainly.com/question/17592356

#SPJ6

If you wanted to test whether or not photosynthesis was occurring, what gas would you test for, carbon dioxide or oxygen?

Answers

Answer:

Carbon Dioxide

Explanation:

1
Select the correct answer from each drop-down menu.
What is the black coat color of Lily's dog?
Lily's dog inherited a gene for his black coat color from his parents. The black coat color is the 1 blank, and the gene is blank

1
trait
genotype
phenotype

2
Structure
Dominant
Recessive

Answers

Answer:

1. Phenotype

2. Dominant

Explanation:

Phenotype of an organisms refers to the noticeable characteristics of such organisms. According to this question, Lily's dog inherited a gene for his black coat color from his parents. The black coat color is the observed trait of such dog, hence, the black coat color is the PHENOTYPE.

The black color allele is dominant over the white color allele in the color gene, hence, the gene that encodes this black color in Lily's dogs is DOMINANT.

Which of the following items are the main inputs, or reactants, in cellular
respiration? Select all correct answers.

A. pyruvate

B. glucose

C. carbon dioxide

D. oxygen

Answers

Answer:

Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.

Energy pyramids represent the amount of energy available to each trophic level(producers and consumers). Give a reasonable explanation as to why the energy is represented by pyramid shape

Answers

Energy pirámide del mundo en un ambiente muy especial en el mundo

When too much water has accumulated in the soil it surfaces and is known as what?

Answers

Answer:

Water logging is the condition, in which too much water accumulates in the soil surface. Water logging can result because of over- irrigation of the agricultural field, the increase of the ground water level and flood. Water logging exerts negative impact on the growth of plants and underground microbial and insect population as water gets accumulated in the soil above it's water retention or absorption capacity. It blocks the pores of soil, where the roots of plants, underground soil microbes and insects receives atmospheric oxygen. It may result in death of soil dependent flora and fauna species.

Explanation:

What nutrient is matched with its correct function?
o A. fats: main source of energy for the body
O B. carbohydrates: building blocks of hormones and vitamins
OC. proteins: used for growth and repair of the body
O D vitamins: secondary source of energy

Answers

Answer:

C

Explanation:

Proteins are used to grow and restore muscle.

Dietary protein aids in cell renewal and repair. Children, teenagers, and expectant women all need protein for healthy growth and development. Therefore, option (C) is correct.

What is the role of protein?

Protein is a nutrient that helps our body cells grow and heal (like blood and muscle cells). Your dry body weight is roughly 50% protein. Protein will be converted to carbohydrates if you don't consume enough of them to give you energy.

The body uses protein for a variety of purposes. It promotes metabolic reactions, supports tissue growth and repair, and synchronizes biological processes. Proteins give your body a structural foundation in addition to preserving a healthy pH and fluid balance.

Learn more about protein, here:

https://brainly.com/question/10945907

#SPJ2

Wich of the following is a function of the nucleus. A. stores DNA B. Stores sugar C. Builds protein D. Packages proteins

Answers

It stores DNA so it’s A

Answer:

it's a

Explanation:

Eukaryotic cells are differentiated from prokaryotic cells
because eukaryotic cells

Answers

Answer: eukaryotic cells are found in plants, animals, fungi, and protist.

Explanation:

point
Look at the diagram shown below.
geo
cooling melting
- Pagma
me ting
Megamorphia
Rock
weathering and
heat and
erosion
pressure
sediments
weathering and
compaction and
erosion
cementation
weathering and
erosion
heat and
pressure
sedimentary
Rock
Which of these statements best summarizes the information provided by the
diagram?
Melting changes metamorphic rocks into sediments.
Heat and pressure change igneous rocks into metamorphic rocks.
Weathering and erosion change sediments into sedimentary rocks.
Cooling changes igneous rocks into magma.

Answers

3 is the answer because it’s correct and the other guy is correct

The best statement that summarizes the information provided by the diagram is heat and pressure change igneous rocks into metamorphic rocks, option (b) is correct.

The diagram implies a process involving the transformation of rocks, and it suggests that the key factor in the conversion is the application of heat and pressure. This aligns with the fundamental process of metamorphism, where pre-existing rocks, including igneous rocks, undergo significant changes in their mineralogy, texture, and structure due to high temperatures and pressures deep within the Earth's crust.

This statement accurately captures the essence of the diagram's representation of rock transformation. It should be noted that the other statements do not align with the depicted process or overlook crucial elements, option (b) is correct.

To learn more about igneous follow the link:

https://brainly.com/question/2500550

#SPJ2

The correct question is:

Which of these statements best summarizes the information provided by the diagram?

a. Melting changes metamorphic rocks into sediments.

b. Heat and pressure change igneous rocks into metamorphic rocks.

c. Weathering and erosion change sediments into sedimentary rocks.

d. Cooling changes igneous rocks into magma.

HELP PLS AND THANK YOU. ILL MARK YOU BRAINLIEST.

How does the probability of success of fertilizations change from predators? (specifically fish fertilizations and predators like turtles)

Answers

Answer:

External fertilization usually occurs in aquatic environments where both eggs and sperm are released into the water. After the sperm reaches the egg, fertilization can then take place. Most external fertilization happens during the process of spawning where one or several females release their eggs and the male(s) release sperm in the same area, at the same time. The release of the reproductive material may be triggered by water temperature or the length of daylight. Nearly all fish spawn, as do crustaceans (such as crabs and shrimp), mollusks (such as oysters), squid, and echinoderms (such as sea urchins and sea cucumbers). Pairs of fish that are not broadcast spawners may exhibit courtship behavior. This allows the female to select a particular male. The trigger for egg and sperm release (spawning) causes the egg and sperm to be placed in a small area, enhancing the possibility of fertilization.

Explanation:

Other Questions
What value goes in cell B? please help me out with this!! Formal writing should have sentences that are varied. What other type of structure should the sentences of formal writing have? (1 point) They should be interesting. They should be long. They should be complex. They should be simple. Question 6 of 10Which of the following is most likely the next step in the series?SUBMIT The measure of angle Q is 70 degrees. Find the measure of angle P. Which of the following correctly pairs a transition with its most closely associated region of the electromagneticspectrum? Read these sentences from Section 3 of "Cool Eye Tricks." It should look like theres a hole in your free hand. The objects in the distance should be visible through this hole. How does this part of Section 3 contribute to the development of ideas in the text? It explains why this trick is so impressive to perform. It tells the reader how this trick is accomplished. It tells the reader the expected outcome of the trick. It explains why this trick is so important to learn. can someone help me with this helppppppppppppppppppppppppp What is the central idea in this passage?Which phrase best supports this central idea?(1) But when cities or countries are accustomed to liveunder a prince, and his family is exterminated, they,being on the one hand accustomed to obey and on theother hand not having the old prince, cannot agree inmaking one from amongst themselves, and they do notknow how to govern themselves. (2) For this reason theyare very slow to take up arms, and a prince can gain themto himself and secure them much more easily. (3) But inrepublics there is more vitality, greater hatred, and moredesire for vengeance, which will never permit them toallow the memory of their former liberty to rest; so thatthe safest way is to destroy them or to reside there.-The Prince,Niccol Machiavelli I tried solving it and I didnt get the right answer can someone explain to me What is one way people can work together and make a difference Math helps us think analytically and have better reasoning abilities. Analytical thinking refers to the ability to think critically about the world around us Analytical and reasoning skills are essential because they help us solve problems and look for solutions. Which of these most completely describes the function of a verb?It is a word used to label an action or a state of being.It is a word used to label a person, place, thing or idea.It is a word used to label an action only. Did humans evolve from sharks? Choose one invention or advancement from early Egypt and describe how it could beconnected back to the Nile River and Egypt's environment. In order to obtain a permit, food service establishments must firstA. obtain a tax ID numberB. apply for initial inspectionC. pay the inspection feeD. pass a food safety exam Give a scientific reason of the following:Soil temprature plays an important role in chemical reactions. What was about to happen where Shays lived? Which number line Shows the graph of -2.75