Which process of genetic recombination involves genes from both parents?
crossing over
independent assortment
fertilization
tetrad formation

Answers

Answer 1

Answer:fertilization

Explanation:

Answer 2

The process of genetic recombination which involves genes from both parents is crossing over. This process occurs during prophase I of meiosis, when homologous chromosomes pair up and exchange genetic material.

Explain the process?

A portion of each parent's chromosome is swapped during this process, resulting in two new chromosomal combinations that are distinct from those of either parent. Genetic variety among the progeny is produced as a result of this process, which is advantageous for evolution.

The process of crossing over is random, therefore it is unpredictable which chromosomal segments will be exchanged. This is crucial for fostering genetic diversity because it allows for a wider variety of genetic combinations to be produced when genetic material is exchanged.

As portions of each chromosome will be exchanged during crossing over, this procedure also aids in ensuring that the offspring obtain a combination of genetic material from both parents.

Learn more about genetic recombination at:

https://brainly.com/question/12685192

#SPJ5


Related Questions

15 points answer please

Answers

Answer:

B

Explanation:

Answer: B
The particles will stop completely

dead cells are removed from the Dermis by phagocytosis. true or false?​

Answers

The answer to your question is false I think.

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

The car shown below is trapped in cooled magma. Do you think that the guy in the car was in the car when the magma flowed from the eruption?

Answers

Answer:yes the car is stuck so yes he was in the car and he can’t get out

Explanation:

Which mammal does not give live birth whale sea cow duck-billed platypus kangaroo dog

Answers

Answer:

Duck-billed platypus

Explanation:

The duck-billed platypus is the only mammal that lays eggs.

true or false
A niche includes just the biotic parts of an environment.

Answers

Answer:

False

Explanation:

An organism's niche includes its environment, behaviors, and interactions. It also includes its role within the environment. The environment consists of living and nonliving components.

i need help with biology if you’re willing to help pls lmk :)

Answers

Answer:

sddssa

Explanation:sa

Which two words best describe the Sun? Select one:
A)planet and gases
B)star and rocky
C) star and gases
D)planet and rocky

Answers

Answer:

I'm pretty sure it would be c

Explanation:

because it is a star so it definitely is not a or d and I don't think it is rocky soooo

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

In the presence of oxygen, _____ molecules of ATP can be formed during cellular respiration.

A. 36 to 38
B. 19 to 24
C. 2 to 4
D. 63 to 68
E. 38 to 42

Answers

the answer is A. 36 to 38 molecules

What are the five main phases of the cell cycle? What are the main events in each?

Answers

Answer:

In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.

Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.

Explanation:

good luck

please mark me as a brainliest

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

Help me PLEASEE!!! IT will mean alot

Answers

It’s probably B (I’m guessing)

Answer:

I believe the answer is C.

Explanation:

Formula is Glucose + 6 Oxygen makes energy, 6 carbon dioxide molecules and 6 water molecules.

why do some scientists believe that humans evolved from apes?

a: because fossil records show homologous structures indicating a common ancestor

b: because humans and apes lived around the same time period

Answers

Answer:

A

Explanation:

Because it is way more logic

A baby is born with phenotypic characteristics of Down’s syndrome ; a rounded face, small chin, almond shaped eyes, and shorter limbs. Evidence from which of these techniques would best confirm the child has an extra chromosome 21

Answers

Answer:

shorter limbs would be the best characteristic to confirm

Explanation:

A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll

Answers

Answer:

GL Gl gL gl

Explanation:

What do ginsenosides do to muscles

Answers

Answer:

Panax ginseng (Chinese or Korean ginseng) has been shown to have similar properties under certain circumstances. McNaughton et al., 1989 noted increases in pectoral strength, quadriceps strength, and post-exercise recovery following dietary supplementation with ginseng root powder.

Explanation:

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Chapter 1 Question: Why didn't the plants and animals in the biodome have
enough energy storage molecules?

Answers

Because there was not enough carbon in abiotic matter.

Which section of the article BEST explains why the development of CRISPR-Cas9 is significant for the scientific community?

Answers

Answer:

It allows the scientists to activate gene expression instead of cutting the DNA.

Explanation:

The development of CRISPR-Cas9 is significant for the scientific community because this development allows the scientists to activate gene expression instead of cutting the DNA. This technique allows the scientists and researchers to study the function of the gene. Before development, Cas9 enzymes produced by the CRISPR system binds to the DNA and cuts it by shutting the targeted gene off so this development of CRISPR-Cas9 enables the scientists to activate gene expression instead of cutting the DNA.

3
ANNOTATE Write the inputs and outputs of cellular respiration on this diagram.

Answers

Answer:

Inputs---- glucose and oxygen.

Outputs----- ATP, carbondioxide and water.

Explanation:

The inputs of cellular respiration are the glucose and oxygen whereas the outputs of cellular respiration are energy in the form of ATP, carbondioxide gas and water. cellular respiration is a process in which glucose is broken down in the presence of oxygen gas for the production of energy in the form of ATP molecules. Carbondioxide gas and water which are the waste materials also produced in the end of cellular respiration process. Cellular respiration is the reverse of photosynthesis.

The 1st organism in a food chain must always be what type of organism?

Answers

Answer:

Producer

Explanation:

I think it should be producer.

Answer:

Producer

Explanation:

The 1st organism in a food chain must always be what type of organism?

Producer

Plz I will give brainliest

Answers

The correct answer is C

Please help biology

Answers

Answer: down

Explanation: bio teacher here

What is the difference between a missense mutation and a silent mutation?

Danke schon! Ilysm <3

Answers

Answer:

Answer is in explanation

Explanation:

A silent mutation is a mutation in which a single nucleotide base is changed, but that change does not effect the amino acid sequence. A missense mutation is a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid.

The mutation is caused by the exchange of one base pair if no change in the overall protein (silence mutation),  if there is change in one amino acid (missense mutation).

What is a silent mutation?

A mutation is a difference in the DNA sequence of an organism.

Silent mutations happen when the difference of a single DNA nucleotide within a protein-coding portion of a gene does not influence the sequence of amino acids and the protein.

Thus, silent mutation has no change whereas stop mutation leads to termination of protein.

To learn more about mutation click here:

https://brainly.com/question/13923224

Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories

Answers

Answer:

D. 367

Explanation:

If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.

What is food energy?

Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.

The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.

To find the total calories, multiply the given biomolecules grams with their calorie count.

= 42 × 4 + 7 × 9 + 34 × 4

= 168 + 63 + 136

= 367 calories

Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.

Learn more about energy, here:

https://brainly.com/question/839331

#SPJ5

Lysogenic viruses do not

Answers

Answer:

Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.

Explanation:

What valuable information was gained from Mendel's dihybrid crosses?

Select all that apply.

1. Not all traits are controlled by genes. In most plants, genes only determine traits that affect
flower color.

2. Statistical and probability methods can be used to determine how likely an offspring is to inherit
certain traits.

3. Genes are inherited differently in plants than they are in animals.

4. Inheritance of one trait does not affect inheritance of another.

Answers

2 and 3 i’m pretty sure according to my calculations it’s 6c6

Mendel's dihybrid cross proves that the inheritance of one trait does not affect the inheritance of another trait. Hence, option 4 is correct.

What is a dihybrid cross?

When two different traits are crossed together then it is called a dihybrid cross. These two different traits are regulated by two different genes.

In Mendel's dihybrid cross, he did cross between round yellow and wrinkled grees. There are two traits, color, and shape. In the F1 generation, all seeds were round yellow but they were heterozygous. Round shape and yellow color are dominant traits.

Then he self-pollinated F2 generation and found four types of seeds that were round yellow, round green, wrinkled yellow, and wrinkled green in the 9:3:3:1 ratio. The cross is attached in the image below.

Inheritance of one trait does not affect the inheritance of another trait. Hence, option 4 is correct.

Learn more about dihybrid cross, here:

https://brainly.com/question/12540319

#SPJ2

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

Tropical rainforests have the greatest biodiversity of any type of land ecosystem how does biodiversity contribute to the sustainability of an ecosystem

Answers

Biodiversity contributes to the sustainability of an ecosystem in ways such as biodiversity, ecosystem stability, ecosystem resilience, nutrient cycling, pollination, and medicinal properties.

Biodiversity is crucial for the sustainability of an ecosystem as it plays a significant role in maintaining the functioning of ecosystems and providing a range of ecological services. In tropical rainforests, which have the highest biodiversity, the presence of numerous species of plants, animals, fungi, and microorganisms contributes to the sustainability of the ecosystem in the following ways:

Ecosystem Stability: Biodiversity helps to maintain the stability of an ecosystem by providing a balance between predator and prey populations, nutrient cycling, and decomposition.

Ecosystem Resilience: The greater the biodiversity of an ecosystem, the more resilient it is to disturbances such as climate change, natural disasters, and human activities.

Nutrient Cycling: Biodiversity helps in the efficient cycling of nutrients in the ecosystem. Different species of plants and microorganisms play a role in decomposing organic matter, recycling nutrients, and maintaining soil fertility.

In summary, biodiversity is essential for the sustainability of ecosystems. It provides ecological services that are critical for maintaining the functioning of the ecosystem and contributing to human well-being.

To learn more about Biodiversity here

https://brainly.com/question/29765125

#SPJ1

Other Questions
PLEASE HELP!!!! PLEASE personajes ambientales de la noche que lo dejaron solo Why is cellular respiration essential for homeostasis? (4 points)To create energy that the cell can useTo make air in the bodyTo remove oxygen from tissuesTo make new types of cells According to the map, the religion of Hinduism is dominant in which area of the world? A. India B. Russia C. North Africa D. Australia Can I add pictures into these things for people to answer? Im lazy, no offense. Ill mark branlist for the best answer!!!Write a paragraph (5-8 complete sentences) answering the promptHow does the availability of resources in ecosystems impact ecosystems? Solutions 5x + 10 = 5x Hey guys i am begging you i really need help!!!!!!!pleaseeeeeeeeeeeeeeeplease can you write a background story for a 90s character that would be on the back of those toys in the boxes the character is Tzar Nicholas 2!!!!!!!!!!!!!!!!!!I am begging you!!!!!!!!!!!!!!!!!!!!!!!! help please!!! just need to answer numbers 1-3 thank you to whoever helps !! :) Which words in the excerpt have positive connotations? How can I achieve becoming an actor one day or a Train Drive? Plz help me out Help if you can!! I really need some good grades or I will fail this and that wont help anything. Sam asked some other children which sport they like. They all choose swimming. Now the most children choose swimming. How many children did Sam ask? Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust? WILL GIVE BRAINLIEST TO CORRECT ANSWER!Priya and Han plan a fundraiser for the running club. They begin with a balance of -80 because of expenses. In the first hour of the fundraiser they collect equal donations from 9 parents, which brings their balance to -44. How much did each parent give? Natalie is almost always on time for class. In fact, the probability that she is on time for a given class is 90%. If there are 50 classes during the semester, what is the best estimate of the number of times out of 50 that Natalie is on time to class? 2x + 6y = -8x - 3y = 8 Listed in the Item Bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into the correct column. The order does not matter.HURRY!! ILL MARK BRAINLIESTTT!! how do i do my blog project if it keeps messing up lol? Two-Part Question: Which of the followingisotopes is best suited to determining the age of a Coelophysis fossil AND does any isotope followthe relationship described in the graph above (yes -or- no)?(A) carbon-14 (yes)(B) potassium-40 (yes)(C) carbon-14 (no)(D) potassium-40 (no)