Which pattern of inheritance will result in three different phenotypes, with one of them
presenting as a blend?
O Codominance
O Multiple Alleles
O Incomplete dominance
O Sex-linked

Answers

Answer 1
Incomplete dominance is when two alleles blend to make a third phenotypic trait

Related Questions

Which of the following is most effective in helping rain forest plants trap
sunlight so that light energy can be converted to chemical energy? *
Large leaf size
Small seed size
Small Stem
Large root size

Answers

Answer:

The picture was NOT a part of that question. The correct answer is Large leaf size. A

Explanation:

Leafs trap sunlight to perform photosynthesis for chemical energy which takes place in the chloroplast.

Photosynthesis is the process by which plants convert light energy into chemical energy. Plants can trap more sunlight if the size of leaves is large. Thus, the correct option is A.

What is Photosynthesis?

Photosynthesis is the process by which plants synthesize their food in the form of carbohydrates (sugars). This process takes place in the chloroplast of cell. It contains chlorophyll pigment. This pigment is responsible for trapping sunlight.

There are more chloroplast present on the leaf surface than other parts of cell. This organelle is responsible for the synthesis of carbohydrates in plants as they trap sunlight which is converted into chemical energy. The more the number of chloroplast in the cell, more will be the rate of photosynthesis in plants.

Therefore, the correct option is A.

Learn more about Photosynthesis here:

https://brainly.com/question/1388366

#SPJ6

Which option would be a good course of action in the followingscenario?
An agronomist discovers that the plants in a field are all infected with a fungus.
A. immediately apply a fungicide
B. do nothing
C. test the fungus to determine if it is beneficial to the plants
D. burn the crop before the infection spreads to other fields

Answers

Answer:

C. test the fungus to determine if it is beneficial to the plants

Explanation:

Some fungi are  good so it's good to check and see what effect it has on the plants.

Answer: test the fungus

Explanation:

just did it edge 2021

What are some advantages of asexual reproduction when compared to sexual reproduction? What are some disadvantages of asexual production when compared to sexual reproduction

Answers

Answer:

produces genetic variation in the offspring.

the species can adapt to new environments due to variation, which gives them a survival advantage.

a disease is less likely to affect all the individuals in a population.

Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACGGGGGCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACAAAATT
Complementary DNA #3:

Answers

Answer:

Complimentary DNA #1:

ATGGCCTACGGTCTAGTTTAG

Complementary DNA #2:

ATGCCCCCGCATTGGTGTTGA

Complementary DNA #3:

ATGGACAATTCGATGTTTTAA

DNA molecule 1: TACCGGATGCCAGATCAAATC, complimentary will be ATGGCCTACGGTCTAGTTTAG, for DNA molecule 2: TACGGGGGCGTAACCACAACT, complimentary will be ATGCCCCCGCATTGGTGTTGA.

What is complimentary DNA?

Humans and nearly all other species carry their genetic information in DNA, also known as deoxyribonucleic acid. The DNA of an individual can be found in almost all of their cells.

The information molecule is DNA. It contains information needed to create proteins, which are other big molecules.

These instructions are dispersed throughout 46 lengthy structures called chromosomes that are found inside each of your cells. Numerous smaller pieces of DNA, known as genes, make up these chromosomes.

Complementary sequence is a sequence of bases in a nucleic acid that can be combined to generate a double-stranded structure.

For instance, G-T-A-C is the complementary sequence to C-A-T-G, where each letter represents for a different DNA nucleotide.

The DNA sequence can be:

DNA molecule 1: TACCGGATGCCAGATCAAATC, complimentary will be ATGGCCTACGGTCTAGTTTAG.DNA molecule 2: TACGGGGGCGTAACCACAACT, complimentary will be ATGCCCCCGCATTGGTGTTGA.DNA molecule 3: TACCTGTTAAGCTACAAAATT, complimentary will be ATGGACAATTCGATGTTTTAA.

Thus, this is the complete match for the given scenario.

For more details regarding DNA, visit:

https://brainly.com/question/29767255

#SPJ2


While walking through a rainforest, a zoologist spots a colorful organism growing on a dead tree stump. Further examination reveals this organism is a
multicellular organism, possesses a nucleus, and has cell walls but no chloroplasts. The zoologist would most likely place this organism into which kingdom?
O A Plantae
OB. Decomposers
C. Prokaryotes
OD. Fungi

Answers

Answer:

D:fungi

Explanation:

The zoologist would most likely place this organism into Fungi kingdom. The correct option is D.

What is kingdom Fungi?

Any member of the eukaryotic group of organisms, which also includes the more well-known mushrooms and microbes like yeast and mould, is referred to as a fungus.

Eukaryotic creatures known as fungi include yeasts, moulds, and mushrooms as well as other microbes.

These organisms fall under the category of fungus. The creatures that make up the Kingdom Fungi are pervasive and have a cell wall.

As a biologist notices a vibrant organism sprouting on a stump from a dead tree.

A closer look reveals that this organism is multicellular, contains a nucleus, cell walls, but no chloroplasts. He probably would have put this organism in the kingdom of fungi.

As prokaryotes and decomposers are not having the characters given by the zoologist and plant also possesses chloroplast, so it can come under Fungi Kingdom.

Thus, the correct option is D.

For more details regarding kingdom Fungi, visit:

https://brainly.com/question/11829903

#SPJ6

does exocytosis require energy?

Answers

Answer:

There are two types of vesicle transport, endocytosis and exocytosis (illustrated in the Figure below). Both processes are active transport processes, requiring energy. Illustration of the two types of vesicle transport, exocytosis and endocytosis.

Explanation:

So in a simple explanation yes they require energy:)

Why didn't Bill Stacy have blue skin even though his mother did?

Answers

Answer:

because bill stacy was sick.

Explanation:

Bill Stacy does not have blue skin even though his mother did because of variations that occur during the segregation of alleles after fertilization.

What do you mean by Variations?

Variations may be defined as the altered appearance among individuals in the same population. It is one of the factors that are responsible for maintaining diversity.

Due to variations, offspring do not identical to their parents. These variations have resulted from either erotic reproduction or mutation.

Therefore, Bill Stacy does not have blue skin even though his mother did because of variations that occur during the segregation of alleles after fertilization.

To learn more about Variations, refer to the link:

https://brainly.com/question/14926046

#SPJ2

BIO, HELP!
you know the drill, if you’re right you get the brailiest
3.
Put the cells below in the correct order for Mitosis to occur.

A-B-D-C

B-A-D-C

C-D-A-B

D-A-B-C

Answers

Answer: last answer option

Explanation:

D - prophase - you can see this by the movement of centrosomes

A - metaphase - lining of chromosomes on metaphase plate

B - anaphase - splitting of sister chromatids

C - cytokinesis - formation of 2 new cells

the correct order is D A B C

A student drew the following diagram to model the structure of a prairie
community. Which level represents short and tall grasses?

A. Level 2
B. Level 1
C. Level 4
D. Level 3

Answers

Answer: B. Level 1

Explanation:

The prairie community is dominated by the grass and vegetation cover. Thus the lower most trophic level in the prairie ecosystem are the short and tall grasses. They produce major source of biomass for the herbivores of the food chain. They consume the grasses can be designated as primary consumers of the food chain. Also the producers which are grasses which make up the large amount of biomass will provide a source of food for the consumers. They will receive 100 percent energy from the sun and they will utilize 90 percent of it to make their food by the process of photosynthesis.  Only ten percent of energy is transferred to the next trophic level.

Answer:

B level 1

Explanation:

What occurs in the brain (with regard to our muscles) as we train and even as we sleep?​

Answers

Is this a multiple choice question??

Which amino acid is best represented by "CCA"? *

Answers

Answer:

Proline

Codon-Amino Acid Abbreviations

Explanation:

Which best defines cloud computing?
оооо
Using a cloud to display the weather
Services, applications, or storage accessed via the Internet
A business propagated using the Internet
A portion of the Internet
.
PLSS HELPPPPPP

Answers

I think the best defines is the third one

The presence of freckles (F) is dominant to no freckles (f). Jake and his mom have
freckles, but his sister and Dad do not have freckles. Complete the Punnett square
that shows Jake's family.

Answers

Answer/Explanation:

(F) => dominant allele for presence of freckles

(f) => recessive allele for no freckles

Since Jake has freckles while his sister has no freckles, therefore:

Jake's dad must be => (ff) (this is the only instance the recessive trait of no freckle can manifest)

Jake's mum would be => (Ff)

Let's complete the Punnett square that shows Jake's family:

Dad------|---f---|---f---|

Mum--F-| Ff | Ff

----------f-| ff | ff

(ff) × (Ff) - Jake's Parent

Ff - Jake

ff - Jake's sister

A simple machine makes work
a. less, easier
b. easier, less
not
C. more, harder
d. harder, less

Answers

Answer:

easier

Explanation:

Answer: A simple machine makes work easier or less harder.

I’ll mark as BRANLIEST!!

30 POINTS!!

Please help me!!

How does DNA change from generation to generation in asexual organisms?

1. Cloning
2.Mutation
3.Variation
4. Gene pairing

Answers

Mutation- asexual means only one parent so it would be a clone but when mutated it changes

Why do hooked seeds spread better than seeds without hooks

Answers

Answer:

Explanation:

Seed has been designed with all sorts of hooks, barbs and sticky gels to provide a good hold on free transportation. ... The seeds' small silky hairs provide feathery parachutes, so a good wind or a good blow can send out for quite some distance.

Answer:

they can get farther and can reach down farther to get the best soil

Explanation:

After an mRNA molecule is constructed from a DNA template, which statement explain what happens next? You should select all
that apply.


A)
The mRNA becomes a double stranded molecule.


B)
The mRNA brings an amino acid to the nucleus.


C)
The mRNA contains a start codon that reads AUG.


D)
The mRNA travels from the nucleus to the ribosome.


E)
The mRNA is exported from the cell through the membrane.

Answers

Answer:

C) The mRNA contains a start codon that reads AUG.

D) The mRNA travels from the nucleus to the ribosome.

Explanation:

mRNA is single stranded. The mRNA does leave the nucleus but does not leave the cell. The mRNA does not carry the amino acids, that job belongs to the tRNA and it brings them to the ribosome.

The formation of the mRNA from the DNA is called transcription. In this process, the mRNA has both the introns and the exons.

The correct option of the following question is D

The replication, transcription all process is occurs in the cytoplasm of the cell. After the process of replication, the DNA moves to the nucleus for the transcription process. The process of the formation of protein from the mRNA is called translation. The translation process occurs in the ribosomes.

The protein formation requires the ribosomes hence the RNA must be transferred to the ribosomes.

Hence, the correct option is D that is the mRNA travels from the nucleus to the ribosome.

For more information, refer to the link:-

https://brainly.com/question/15804584

Produces what a plant needs to use to stay alive

Answers

Plants, like all living organisms, have basic needs: a source of nutrition (food), water, space in which to live, air, and optimal temperatures in order to grow and reproduce. For most plants, these needs are summarized as light, air, water, and nutrients (known by the acronym LAWN).

When a new viral infection appears in a population,scientists usually try to develop a vaccine against the virus. Which substances would most likely be contained in the new vaccin

Answers

Answer:

Antigen, stabilizers, surfactants, diluents, preservatives

Explanation:

Antigen: This is part of the protein structure virus or part of its genetic material. These parts are active. But sometimes, the inactivated form of the virus is also included in the vaccine. Stabilizers: Avoid other chemical reactions occurring in the interior of the vaccine. Surfactants: They prevent the occurrence of sedimentation and agglutination of the elements inside the vaccine. Diluent: Used to dilute the vaccine in an appropriate concentration before being used.  Preservatives: As the word says, preservatives avoid any possible contamination of the vaccine. These elements´ use depends on the doses prepared. If it is only for one-person use, then they are not needed. But if the doses are to be used by more than one person, they need preservatives because once the vaccine is opened it is vulnerable to contamination.

please help (repost)

ACTUAL ANSWERS and braincells are required

5 How does the presence of coal on Antarctica indicate a climate change?

The discovery of a new coal deposit means people will be able to use this found fuel longer.

Coal forms from the remains of plants that lived in tropical swamps millions of years ago, Coal deposits can tell scientists what the composition of the atmosphere was in the past.

Coal is burned for fuel and it releases carbon dioxide into the atmosphere.​​

Answers

Answer:

The discovery of a new coal deposit means people will be able to use this fossil fuel longer.

Coal is burned for a fuel and releases carbon dioxide into the atmosphere.

Which two factors are most likely to cause a plants guard cells to open its stomata.


Please help, I was seeing different responses to this question:)

Answers

Answer: The answer is in the picture

Explanation:

espero que esto ayude <3

Hope this helps <3

Hummingbirds drink nectar from flowers. Which beak shape would BEST help a hummingbird survive in a place where the flowers are shaped as shown in the picture?
THIS IS HISTORY BTW

Answers

Answer:

A

Explanation:

the beak is long and curved so the A beak would be perfect (give BRAINLEST please)

Answer:

The best answer would be A.

Explanation:

Answer A. is the best answer because the beak is longer and curved easier for drinking.

Match the human activity with how it intensifies the greenhouse effect.
deforestation
burning fossil fuels
waste disposal in landfills
primary cause of human-created
carbon emissions
destroys natural carbon sinks,
leading to more co, in the air
emits methane from decomposing
matter

Answers

Human activities are changing Earth's natural greenhouse effect. Burning fossil fuels like coal and oil puts more carbon dioxide into our atmosphere. ... Too much of these greenhouse gases can cause Earth's atmosphere to trap more and more heat. This causes Earth to warm up.

DNA has four nitrogenous bases:
• ________________ that pairs with _________________ (Apple Tree)
• _________________ that pairs with _________________ (Car Garage)

Answers

Answer:

Adenine pairs with thymine

Cytosine pairs with guanine

Explanation:

The four nitrogenous bases: Adenine, Thymine, Cytosine and Guanine

Remember Apple Tree

Apple Tree = Adenine Thymine

and remember car garage

Car Garage = Cytosine Guanine

Answer:

Adenine pairs with thymine

Cytosine pairs with guanine

Explanation:

Hope this helps

The diagram below shows a single animal cell with many of the cells organelles. Which structure contains the instructions for making a copy of the cell?

Answers

Answer:

The nucleus (On the image, it's the sphere in the middle)

It is the nucleus, which contains the instructions for making a copy of the cell.

What is a nucleus and its functions?

It is a double-membrane-bound cell organelle found only in the eukaryotes, which comprises the genetic material. The prime function of the nucleus is to monitor a cell's reproduction and growth. It does not only store DNA, it also performs various essential cellular procedures.

The duplication of the DNA, that is, DNA replication takes place within the nucleus of the cell. It comprises the instructions for producing two identical copies of the cell, and each cell produced will get its own set of instructions. It is also the site for the process of transcription.

Thus, the nucleus is the structure that comprises the instructions for producing a copy of the cell.

Find out more information about nucleus here:

https://brainly.com/question/9260716

what is a mutagen? pls

Answers

Answer:

the answer is B

Explanation:

Explain why the genes make the cell growth controller. The protein synthesis indicator and the DNA repair protein are active in all the cells.

Answers

Answer:

man im not sure

Explanation:

help is very much appreciated <3 (7th grade science)

Answers

Answer:

1. N/A

2. a cell

3. organ system

4.Tissues are groups of similar cells that have a common function. While an organ is a structure that is composed of at least two or more tissue types and performs a specific set of functions for the body.

5.

nervous system - The nervous helps the whole body communicate, our body needs to communicate so we can actually do things like breathing.

respiratory system - The respiratory system gives cells the oxygen they need to survive, and cells keep humans alive. Humans cannot survive without breathing.

digestive system - The digestive system is important for breaking down foods into nutrients, those nutrients are then used to heal and nourish the human body. The digestive system also helps us pass toxic wastes that build up in our bodies, so we don't get sick.

--------------

hope this helps :)

Glucocorticoids are steroid hormones that control cellular responses through several different signaling pathways. One of the signaling pathways involves the glucocorticoid receptor, an intracellular protein that is activated by binding to a glucocorticoid molecule. A simplified model of the glucocorticoid receptor signaling pathway is represented in Figure 1.
Which of the following statements best predicts the effect of a mutation that results in a loss of the glucocorticoid receptor’s ligand binding function?

Answers

Answer:

The answers are A and B.....

How do the laws of genetics (discovered by Mendel) govern what variations can and cannot be
possible in the offspring of any 2 sexually reproducing organisms? (List and define each of the 3 laws as
you answer this questions

Answers

The Mendel's laws of inheritance include law of dominance, law of segregation and law of independent assortment.

Some of the key elements of Mendel’s original model were:
Heritable traits are determined by heritable factors, now called genes. Genes come in pairs (that is, are present in two copies in an organism).
Genes come in different versions, now called alleles. When an organism has two different alleles of a gene, one (the dominant allele) will hide the presence of the other (the recessive allele) and determine appearance.
During gamete production, each egg or sperm cell receives just one of the two gene copies present in the organism, and the copy allocated to each gamete is random (law of segregation).
Genes for different traits are inherited independently of one another (law of independent assortment).
Other Questions
PLEASE HELP ME!!! IVE BEEN STUCK ON THIS FOR SO LONG!! Select the statement that BEST answers the following questionbased on the information providedMilk is uniformly mixed it contains several compounds-water, proteins, fats, and sugars. Is milk considered asubstance or a mixture?It is a liquid substance with uniform compositionb It is a mixture, only solids are pure substances.It is a mixture that can be separated by physicalmeansdIt contains compounds and is therefore asubstance Solve and DONT simplify 9/18 + 1/3 True or False: The Townshend Acts were a direct response by the British government tothe Boston Tea Party.A. TrueB. False which of the following quotes best supports the answer to part A declaration of sentiments and resolutions Urgent! E is directly proportional to F.When E = 2, F = 8(a) Find an equation for E in terms of F.(b) Find the value of E when F = 30(C) Find the value of F when E = 100 20Select the correct answer from each drop-down menu.Nate has written a narrative that draws on and transforms Shakespeare's play Julius Caesar. Which words would add the best sensory detail tohis narrative?Brutus felt the BLANK breeze from the window blow his hair back away from his face. The morning sun beat down into thebackseat of his friend Julius's Ford Thunderbird. The fully restored car had been a gift for his 16th birthday. Brutus thought Julius hadbeen acting a little smug since he'd gotten the car, but it was nice that Julius drove all their friends to school. Brutus and Cassius werestretched out in the backseat with their backpacks. Met usually rode in the passenger seat and their driver, Julius, usually BLANKthe music loudly for their morning drive. They'd all been friends for as long as they could remember.A. Slow-movingStrongRefreshingB. BlaredTurned onPlayed what questions do yall have about the colosseum what does buenas noches stand for in English? If an object moves 75 m/s in 15 seconds, how far did the object move? Writing on Life During this Pandemic Some people argue that harsh punishments (capital punishment, life sentences, or ancient punishments like cutting off a hand for stealing) for criminals will reduce crime rates. Do you think that harsh punishments reduce crime? Why or why not? What is the gcf of 44n and 55nPLEASE HELP June earns $50 a week for babysitting. Shesaves 1/4 of it and keeps 1/5 for bus fare andgives her mother the rest. How much moneydoes her mother get? The region between theeast coast and theMississippi River becamemore densely populatedbetween 1790 and 1860. What are the treatment modalities and approach for a patient diagnosed with Hyperthyroidism? What is the area of the shaded region?16 cmA. 25.16 cmB. 27.52 cmC. 50.24 cmD. 55.04 cm Help me with this!!! I will mark Brainliest Since 1900, the Audubon Society has conducted an annual Christmas bird count, documenting the number of birds of each species seen in locations across the country. In the 2011 Christmas bird count, there were 3,813 red-tailed hawks seen and counted in Texas. In the 2012 count, there were 4,511 red-tailed hawks counted in Texas. Calculate the growth rate by dividing the difference in the numbers seen in the two years by the number seen in 2011. Then use this value to calculate the estimated population of red-tailed hawks in Texas in 2022, if the growth rate remains constant. Pls HELP THANKS A smaller number is 3 less than half a larger number. The larger number is 10 times 1 less than the smaller number.Let x represent the smaller number, and let y represent the larger number. Which equations can be used to model thesituation? Check all that apply.X equals 1/2 Y -32X minus Y equals -62X minus Y equals -3X equals 1/2 ( Y -3)Y equals 10 (X -1)