Which of these does not represent a direct transfer of carbon

1.Air to trees
2.Giraffe to tree
3.Tree to Giraffe

Answers

Answer 1
The answer is tree to giraffe. Trees need carbon to make oxygen. Giraffes give off carbon when they exhale.

Related Questions

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Other Questions
Which expression is equivalent to 3 4 x + 5 7 + 1 2 x 34 x + 5 - 7 + 12x? A. 54x254x-2 B. 46x246x-2 C. 14x+1214x+12 D. 46x+1246x+12 19 students were surveyed on the number of hours of Netflix they watched last week.The data from the survey is below:{0, 1, 1, 2, 2, 2, 3, 3, 3, 4, 4, 4, 4, 5, 5, 6, 6, 10, 11}What is the range in hours spent watching Netflix?Show your work for full points! What length (in feet) along the circumference of a wheel with a radius of 1 foot is covered in a rotation of 260?A 139B 913C 269D 1318 please help its my last question 20 points and ill give brainliest :) what are the examples of veriable costs Read the sonnet.Sonnet XIIby William ShakespeareWhen I do count the clock that tells the time,And see the brave day sunk in hideous night;When I behold the violet past prime,And sable curls all silvered o'er with white;When lofty trees I see barren of leaves Which erst from heat did canopy the herd,And summer's green all girded up in sheavesBorne on the bier with white and bristly beard,Then of thy beauty do I question make,That thou among the wastes of time must go, Since sweets and beauties do themselves forsakeAnd die as fast as they see others grow; And nothing 'gainst Time's scythe can make defence Save breed, to brave him when he takes thee hence.Read the first quatrain of "Sonnet XII."How does the rhyming of time with prime affect the poem? It encourages the reader to read the poem aloud. It emphasizes the quatrain's theme of the passage of time. It shows how time and prime share the same meaning. It makes the language easier to understand. HELP!!!!!!!!!!!!!!!!!!!!!!!!!! Ethan goes to a store an buys an item that costs a dollars. Hehas a coupon for 5% off, and then a 9% tax is added to thediscounted price. Write an expression in terms of x thatrepresents the total amount that Ethan paid at the register. Which group organized the protests against the pass laws? Pls I need help Im begging u pls I need help Please help Brainliest for the correct answer Read the excerpt from "The Quarrel" from "Stories from the Iliad."Drunkard, with the eyes of a dog and the heart of a deer! Never fighting in the front of the battle! You would rather go round and rob the prizes from any man who stands up to you. I swear to you, that from this time forth, you may look for Achilles but you shall not find him. When your men fall dying by the murderous hand of Hector, you shall not know how to help them, and you shall tear your heart with rage for the hour when you wronged the best of the Achaeans.What effect does the phrase "with the eyes of a dog and the heart of a deer" have on the meaning of the excerpt from "The Quarrel"?A. It underscores Agamemnon's deception and grace.B. It underscores Agamemnon's power and swiftness.C. It emphasizes Agamemnon's greed and cowardice.D. It emphasizes Agamemnon's lack of sophistication. giorgio vargani and The secret paint. Solve for X. (x+7)^211=0 Complete las siguientes oraciones con la forma correcta de la palabra o frase que falta. (20 puntos, 2 puntos/ejemplo numerado [numbered item]) 1. Este puesto como agente de viajes me interesa mucho, voy a llenar _____ ahora mismo. 2. Mi hermano _________ (estudiar, ir + a) ingeniera ambiental pero decidi que en realidad tena ms habilidades para ser programador de computadoras. 3. Cunto tiempo hace que Carla _________ (trabajar, presente progresivo) para esta empresa? 4. Voy a _______ (vestir, vestirse) muy bien porque tengo una entrevista con el gerente de una gran empresa. 5. Queremos crear una organizacin _______ , o sea, una compaa que no piense en ganar dinero para s misma. 6. ________ (requerir en voz pasiva) mujeres y hombres simpticos para ayudar a los pacientes que sufren de cncer. 7. Este verano, vamos a viajar por toda Europa _______ (por, para) un mes. 8. Ya no vivimos en la ciudad _______ (sino, pero) en el campo. 9. Cuando se necesita dinero para ayudar a los pobres, a veces los voluntarios tienen que ______ fondos. 10. En el futuro, si me quedo sin trabajo, ______ (hacer) otra cosa. brainliest help fast plz Lucy is not wearing sandals. plz, answer this question without putting LINKS OR FILES!!!!! plz and thank youwhat ordered pair is C located on the coorndiate plane HRLPFCHfUvFuShdhhshdhdu I will mark brainliest for right answers In the diagram below of triangle CDE, F is the midpoint of CE andG is the midpoint of DE.If m ECD = 51 7x, and mZEFG = -8x +53, what is the measure of ZECD?