Which of the following statements about models is true? help me ​

Which Of The Following Statements About Models Is True? Help Me

Answers

Answer 1
All of these statements are true.

Related Questions

describe the six functions of membrane proteins

Answers

Answer:

All enzymes are a type of protein. As a result, a membrane protein that is embedded into the membrane can sometimes be an enzyme, which may have its active site facing substances outside of the lipid bilayer.

These types of enzymatic membrane proteins can work in teams to carry out the steps in a particular metabolic pathway, for instance breaking down lactose into carbohydrate and then monosaccharides.

Membrane proteins can allow hydrophilic molecules to pass through the cell membrane. Transport membrane proteins come in many forms, and some require energy to change shape and actively move molecules and other substances across the cell membrane. They do this by releasing ATP to use as an energy source.

Anchorage: become points of attachment for the cytoskeleton and the extracellular matrix

Some membrane proteins can feature a binding site. These binding sites are characterized by specific shapes that match the shape of a chemical messenger. For example, these chemical messengers can be hormones.

When a hormone meets with the cell wall, it will connect with a receptor membrane protein that is embedded inside the cell wall. The hormone can change the receptor protein and cause a specific reaction, depending on the type of hormone or other substance, will take place within the cell.

Another important function of membrane proteins is in identification and recognition between cells. This particular function is useful in the immune system, as it helps the body to recognize foreign cells that may be causing infection, for instance. Glycoproteins are one type of membrane protein that can carry out cell recognition.

Adjacent cells may have membrane proteins that connect in a range of different junctions. Gap junctions and tight junctions.

This function helps cells to communicate with one another, and to transfer materials between one another.

Membrane proteins are important in the cytoskeleton, the system of filaments and fibers in the cytoplasm of a cell, and the extracellular matrix (ECM), which is the network of macromolecules found outside of cells, such as collagen, enzymes, and glycoproteins, to membrane proteins.

Attaching filaments or fibers in the cytoplasm found throughout the cell can help the cell to maintain its particular shape. It also keeps the location of membrane proteins stable.

Attaching membrane proteins to the extracellular matrix can help the ECM to mediate changes that occur in extracellular and intracellular environments.

Several diseases are linked to mutations within membrane proteins. One example is a mutation called V509A, found in the thyrotropin receptor, thyrotropin being a hormone secreted by the pituitary gland that regulates the production of thyroid hormones.

This mutation increases the activity of the thyrotropin receptor and leads to congenital hyperthyroidism, a condition that can cause changes in mood, sleep problems, and stomach problems.

Other diseases that are linked to mutations in membrane proteins include hereditary deafness, Charcot-Marie-Tooth disease, which damages the peripheral nerves outside the central nervous system, and Dejerine-Sottas syndrome, that affects a person’s ability to move.

Explanation:

How do genetics (genetic predisposition) and the environment work together to cause substance abuse in individuals? What is the likely role of epigenetics in this process?

Answers

Answer: The drug abuse is influenced by the environment and exerts influence on the gene expressions.

Explanation:

The genetic make up of the person is decides, which genes will be expressed and develop a trait in an individual. But this genetic expression can be influenced by the environmental factors like food, exposure to sunlight, and others. This study which relate environment with the genetic make up is called epigenetics. No person is drug addict by birth but the consumption of drug can influence the genetic make up and traits in a abuser. So here, the environment is influencing the genetic basis of a abuser.

Pea plants can have yellow seeds or green seeds Which conclusion about the meaning of Y is correct if the allele
combination Yy is for yellow seeds?
O yellow and dominant
O green and recessive
O yellow and recessive
Ogreen and dominant
Save and Exit
Next
Submit
Mark this and retum

Answers

Answer:

yellow and dominant

Explanation:

Gregor Mendel has stated that a gene comes with two alleles. According to his law of dominance, one of the alleles called DOMINANT allele is capable of masking the phenotypic expression of another allele called RECESSIVE allele.

In this question involving a seed color gene, which has two alleles Y and y. Y, which represents the dominant allele codes for the YELLOW trait while y, which represents the recessive allele codes for the GREEN trait. Therefore, a plant with Yy will have YELLOW SEEDS because the dominant allele (Y) is present.

what is a non example of chloroplast?

Answers

Answer:

"Mitochondria" is the non-example of the chloroplast.

Explanation:

Hope this Helps!

Answer:

the awnser to your question is Mitochondria

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

2 points
C-C-C-H
TL 1
H H H
---
I-U-I
I
I-U-I
I-O-I
I-O-I
I-0-1
I
1
Name the following molecule*
I-O-I
1
O=0
I-O

Answers

Can I see the picture it might help

iodine oxide? there's a lot going on i can't really tell

What is the function of the nucleus of a cell.​

Answers

Answer:it coordinates cell activities like protein synthesis and cell division. Anatomically the nucleus is made up of several components: nuclear envelope, nuclear lamina, nucleolus, chromosomes, nucleoplasm are some of these components.

Explanation:

Answer:

The nucleus controls and regulates the activities of the cell and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.

Explanation:

Like nutrients and water, energy also recycles through an ecosystem,True Or False?​

Answers

Answer:

Explanation:

True

HELP PLZ!!!

15. (01.04 LC) Which of the following best defines average speed? (3 points)

1: It is the speed of an object in a specific direction.

2: It is an object's speed at a specific point in time.

3:It is the total distance traveled over the total time.

4: It is a measure of how far an object moves in a certain time.​

Answers

Answer:

4: It is a measure of how far an object moves in a certain time.

Explanation:

Hope this helps

At which points (A, B, C, or D) in the curve is light a limiting factor?

Answers

Answer:

D

Explanation:


. the negatively charged part of an atom

Answers

Answer:

Electrons are the negatively charged particles of an atom. Together, all of the electrons of an atom create a negative charge that balances the positive charge of the protons in the atomic nucleus. Electrons are extremely small compared to all of the other parts of the atom. The mass of an electron is almost 1,000 times smaller than the mass of a proton.

Explanation:

I hope this helped!

why are cells considered the most basic unit of life​

Answers

Answer:

Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages.

Explanation:

That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.

Hope this helps :)

Answer:  "Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages. That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.''

Explanation:

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule

Answers

Molecule dddddddddddddd
It is a molecule because you can already cross out cell and matter and atom.

Question 1 of 25
An engineer is designing a tire for heavy machinery, Which statement
describes the clearest constraint that applies to the solution?
A. It must be affordable for consumers.
B. It must be designed so that it has an appealing appearance,
C. It must cost the consumer less than $200 per tire.
D. It must function safely under a heavy load,

Answers

Answer: C. It must cost the consumer less than $200 per tire.

Which statement describes one feature of a mineral's definite chemical composition?
It always occurs in pure form.
It always contains certain elements.
It cannot form from living or once-living materials.
It cannot contain atoms from more than one element.
ОО

Answers

Answer:

It always contains certain elements

Explanation:

Just took the test

Answer:

it always contains certain elements

Explanation:

Edge!

if someone can answer it without saying idk by november 2nd 2020 will be marked the brainliest! how does the nervous system work with the digestive system to make jump roping possible??please answer asap​

Answers

The autonomic nervous system controls the tone of the digestive tract. The brain controls drinking and feeding behavior. The brain controls muscles for eating and elimination. The digestive system sends sensory information to the brain.

do woody stems die off each winter and grow back the next spring

Answers

no they can survive the winter

How are luminosity and magnitude related?
(In your own words) ​

Answers

Answer:

Luminosity is an intrinsic(natural) measurable property of a star independent of distance. The concept of magnitude, on the other hand, incorporates distance. The apparent magnitude is a measure of the diminishing(decrease) flux of light as a result of distance according to the inverse-square law.

What is RNA and list and explain the 3 different types of RNA.

Answers

Answer:

RNA is Ribonucleic acid

mRNA

rRNA

tRNA,

Explanation:

mRNA, or messenger RNA, that serve as temporary copies of the information found in DNA; rRNA, or ribosomal RNA, that serve as structural components of protein-making structures known as ribosomes; and finally, tRNA, or transfer RNA, that ferry amino acids to the ribosome to be assembled

hey can you help me with some questions​

Answers

Answer: i need this answer also

Explanation:

Which of the following measurements is the most precise?
165mg
O 164.5mg
164.47mg

Answers

Answer:

164.47mg

Explanation:

Precise means the most accurate

Which process connects glycolysis and the citric acid cycle?

A)lactic acid formation
B)acetyl COA formation
C)electron transport
D)Krebs cycle

Answers

Answer:

b

Explanation:

because my maam said this same question in grade 7

The process of making proteins is called​

Answers

Answer:

translation

Explanation:

Answer:

Translation

Explanation:

Find the difference between testosterone and the steroid molecule.

Brainliest!

Answers

Answer:

It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.

Explanation:

does this help :)

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

PLS I need someone to upload a photo of the answer!

Answers

Answer:

See the file bellow

Explanation:

if you climbed up a hill,which of these statements would be true

Answers

c because yeah it’s c

Answer:

A. your weight would increase because you're farther away from Earth's center

Explanation:

honestly I'm guessing

let me know if this helps

Can dependent variables be manipulated?

Answers

I believe they can..hope it’s right for you :)

Answer:

The Dependent and Independent Variables

The independent variable is the variable that is controlled and manipulated by the experimenter. ... The dependent variable is the variable that is measured by the experimenter. In our previous example, the scores on the test performance measure would be the dependent variable.                                              Hope this helps leave heart c:

Which is true about all unicellular and multicellular organisms?
O They are made of one cell.
O They reproduce.
They cause infections.
O They are made of multiple cells.

Answers

They both reproduce
Other Questions
Please help what is the answer WILL MARK BRAINLIEST FOR BEST ANSWERWhat is a good counterargument for the point "Monitoring your kid's internet safety betrays their trust What is the Finder?0the place where the most commonly used Mac applications resideOthe default Mac applicationthe library used by software developers to create familiar interfaces for applicationsthe place where lists of commands can be found What is the slope of the line y+4=1/2(x-3)A. -3B. 1/2C. 1D. 2E. 3F. 4 Jewish people needed to be brought to cities so that the Nazis could: * Jins soccer team has 4 coaches and 22 players, and his twin sisters team has 2 coaches and 11 players. If the relationship between the number of players and coaches is proportional throughout the league, which ordered pair could represent the total number of coaches and players in the entire league?xy21142224 coaches and 120 players26 coaches and 143 players28 coaches and 168 players30 coaches and 180 players Help me please I need help Which of the following correctly completes the table?A, A=DNA or RNA, B=cell fuel and support, C=galactose and glycogen, D=nucleic acids and fatty acidsB,A=DNA or RNA, B=cell fuel and support, C=galactose and glycogen, D=nucleic acids and fatty acidsC, A=fructose and lipids, B =cell control and fuel, C=enzyme and catalyst, D=nucleotides and myosinD, A=hemoglobin and insulin, B=cell control and reproduction, C=deoxyribose and ribose, D=sugars and lipids which function is increasing Which statement best describes how an existing theory is often affected by the development of new technology?A.) An existing theory is thrown out and replaced with a completely new theory based on the new observations.B.)An existing theory is modified so that it can explain both the old and new observations.C.)An existing theory remains the same because a theory is a proven fact that is always true.D.)An existing theory is kept unchanged while a new theory is developed to explain the new observations. HURRY!! THIS ASSIGNMENT IS DUE IN 5MIN!!! THANK YOU!!!!!!GEOMETRY A container company wants to make a cylindrical cardboard container with a volume of 4752 cubic inches. The formula V = roh represents the volume of a cylinder. In this formula, V represents the volume, represents the radius of the cylinder's base, and h represents the height of the cylinder. Solve for h. What height should the company make the container if the radius of the base must be 9 inches? difference between patrick henreys speech and thomas paines speech 76 divided by 12 in a lixed fraction Which of the following determines how we interpret language? Ethan digests a piece of toast. He is using _____.smooth musclestriated musclecardiac muscle Glassworks Inc. produces two types of glass shelving, rounded edge and squared edge, on the same production line. For the current period, the company reports the following data. Rounded Edge Squared Edge Total Direct materials $ 9,500 $ 21,600 $ 31,100 Direct labor 6,200 11,800 18,000 Overhead (300% of direct labor cost) 18,600 35,400 54,000 Total cost $ 34,300 $ 68,800 $ 103,100 Quantity produced 10,500 ft. 14,000 ft. Average cost per ft. (rounded) $ 3.27 $ 4.91 Glassworks's controller wishes to apply activity-based costing (ABC) to allocate the $54,000 of overhead costs incurred by the two product lines to see whether cost per foot would change markedly from that reported above. She has collected the following information. Overhead Cost Category (Activity Cost Pool) Cost Supervision $ 2,160 Depreciation of machinery 28,840 Assembly line preparation 23,000 Total overhead $ 54,000 She has also collected the following information about the cost drivers for each category (cost pool) and the amount of each driver used by the two product lines. (Round activity rate and cost per unit answers to 2 decimal places.) Usage Overhead Cost Category (Activity Cost Pool) Driver Rounded Edge Squared Edge Total Supervision Direct labor cost ($) $ 6,200 $ 11,800 $ 18,000 Depreciation of machinery Machine hours 400 hours 800 hours 1,200 hours Assembly line preparation Setups (number) 32 times 93 times 125 times Required:Use this information to (1) assign these three overhead cost pools to each of the two products using ABC, (2) determine average cost per foot for each of the two products using ABC, and (3) compare the average cost per foot under ABC with the average cost per foot under the current method for each product. For part 3, explain why a difference between the two cost allocation methods exists. the best comebacks get brainlist (X-7)(3x+2) need answer!! When an organism consumes other organisms for food they are? HELP ME ANSWER THIS PLEASE 15 points