describe the six functions of membrane proteins
Answer:
All enzymes are a type of protein. As a result, a membrane protein that is embedded into the membrane can sometimes be an enzyme, which may have its active site facing substances outside of the lipid bilayer.
These types of enzymatic membrane proteins can work in teams to carry out the steps in a particular metabolic pathway, for instance breaking down lactose into carbohydrate and then monosaccharides.
Membrane proteins can allow hydrophilic molecules to pass through the cell membrane. Transport membrane proteins come in many forms, and some require energy to change shape and actively move molecules and other substances across the cell membrane. They do this by releasing ATP to use as an energy source.
Anchorage: become points of attachment for the cytoskeleton and the extracellular matrix
Some membrane proteins can feature a binding site. These binding sites are characterized by specific shapes that match the shape of a chemical messenger. For example, these chemical messengers can be hormones.
When a hormone meets with the cell wall, it will connect with a receptor membrane protein that is embedded inside the cell wall. The hormone can change the receptor protein and cause a specific reaction, depending on the type of hormone or other substance, will take place within the cell.
Another important function of membrane proteins is in identification and recognition between cells. This particular function is useful in the immune system, as it helps the body to recognize foreign cells that may be causing infection, for instance. Glycoproteins are one type of membrane protein that can carry out cell recognition.
Adjacent cells may have membrane proteins that connect in a range of different junctions. Gap junctions and tight junctions.
This function helps cells to communicate with one another, and to transfer materials between one another.
Membrane proteins are important in the cytoskeleton, the system of filaments and fibers in the cytoplasm of a cell, and the extracellular matrix (ECM), which is the network of macromolecules found outside of cells, such as collagen, enzymes, and glycoproteins, to membrane proteins.
Attaching filaments or fibers in the cytoplasm found throughout the cell can help the cell to maintain its particular shape. It also keeps the location of membrane proteins stable.
Attaching membrane proteins to the extracellular matrix can help the ECM to mediate changes that occur in extracellular and intracellular environments.
Several diseases are linked to mutations within membrane proteins. One example is a mutation called V509A, found in the thyrotropin receptor, thyrotropin being a hormone secreted by the pituitary gland that regulates the production of thyroid hormones.
This mutation increases the activity of the thyrotropin receptor and leads to congenital hyperthyroidism, a condition that can cause changes in mood, sleep problems, and stomach problems.
Other diseases that are linked to mutations in membrane proteins include hereditary deafness, Charcot-Marie-Tooth disease, which damages the peripheral nerves outside the central nervous system, and Dejerine-Sottas syndrome, that affects a person’s ability to move.
Explanation:
How do genetics (genetic predisposition) and the environment work together to cause substance abuse in individuals? What is the likely role of epigenetics in this process?
Answer: The drug abuse is influenced by the environment and exerts influence on the gene expressions.
Explanation:
The genetic make up of the person is decides, which genes will be expressed and develop a trait in an individual. But this genetic expression can be influenced by the environmental factors like food, exposure to sunlight, and others. This study which relate environment with the genetic make up is called epigenetics. No person is drug addict by birth but the consumption of drug can influence the genetic make up and traits in a abuser. So here, the environment is influencing the genetic basis of a abuser.
Pea plants can have yellow seeds or green seeds Which conclusion about the meaning of Y is correct if the allele
combination Yy is for yellow seeds?
O yellow and dominant
O green and recessive
O yellow and recessive
Ogreen and dominant
Save and Exit
Next
Submit
Mark this and retum
Answer:
yellow and dominant
Explanation:
Gregor Mendel has stated that a gene comes with two alleles. According to his law of dominance, one of the alleles called DOMINANT allele is capable of masking the phenotypic expression of another allele called RECESSIVE allele.
In this question involving a seed color gene, which has two alleles Y and y. Y, which represents the dominant allele codes for the YELLOW trait while y, which represents the recessive allele codes for the GREEN trait. Therefore, a plant with Yy will have YELLOW SEEDS because the dominant allele (Y) is present.
what is a non example of chloroplast?
Answer:
"Mitochondria" is the non-example of the chloroplast.
Explanation:
Hope this Helps!
Answer:
the awnser to your question is Mitochondria
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answer:
1 and 5
Explanation:
https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question
Answer:
1.ATTAGC(ATACTAC)GGGC
5. ATGAATGC(ATACTACC)GGGC
2 points
C-C-C-H
TL 1
H H H
---
I-U-I
I
I-U-I
I-O-I
I-O-I
I-0-1
I
1
Name the following molecule*
I-O-I
1
O=0
I-O
Can I see the picture it might help
iodine oxide? there's a lot going on i can't really tell
What is the function of the nucleus of a cell.
Answer:it coordinates cell activities like protein synthesis and cell division. Anatomically the nucleus is made up of several components: nuclear envelope, nuclear lamina, nucleolus, chromosomes, nucleoplasm are some of these components.
Explanation:
Answer:
The nucleus controls and regulates the activities of the cell and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.
Explanation:
Like nutrients and water, energy also recycles through an ecosystem,True Or False?
Answer:
Explanation:
True
HELP PLZ!!!
15. (01.04 LC) Which of the following best defines average speed? (3 points)
1: It is the speed of an object in a specific direction.
2: It is an object's speed at a specific point in time.
3:It is the total distance traveled over the total time.
4: It is a measure of how far an object moves in a certain time.
Answer:
4: It is a measure of how far an object moves in a certain time.
Explanation:
Hope this helps
At which points (A, B, C, or D) in the curve is light a limiting factor?
Answer:
D
Explanation:
. the negatively charged part of an atom
Answer:
Electrons are the negatively charged particles of an atom. Together, all of the electrons of an atom create a negative charge that balances the positive charge of the protons in the atomic nucleus. Electrons are extremely small compared to all of the other parts of the atom. The mass of an electron is almost 1,000 times smaller than the mass of a proton.
Explanation:
I hope this helped!
why are cells considered the most basic unit of life
Answer:
Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages.
Explanation:
That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.
Hope this helps :)
Answer: "Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages. That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.''
Explanation:
A cell membrane has permeability, which means that the membrane:
Answer:
transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.
Explanation:
I barley know what your trying to say
Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule
Question 1 of 25
An engineer is designing a tire for heavy machinery, Which statement
describes the clearest constraint that applies to the solution?
A. It must be affordable for consumers.
B. It must be designed so that it has an appealing appearance,
C. It must cost the consumer less than $200 per tire.
D. It must function safely under a heavy load,
Which statement describes one feature of a mineral's definite chemical composition?
It always occurs in pure form.
It always contains certain elements.
It cannot form from living or once-living materials.
It cannot contain atoms from more than one element.
ОО
Answer:
It always contains certain elements
Explanation:
Just took the test
Answer:
it always contains certain elements
Explanation:
Edge!
if someone can answer it without saying idk by november 2nd 2020 will be marked the brainliest! how does the nervous system work with the digestive system to make jump roping possible??please answer asap
do woody stems die off each winter and grow back the next spring
no they can survive the winter
How are luminosity and magnitude related?
(In your own words)
Answer:
Luminosity is an intrinsic(natural) measurable property of a star independent of distance. The concept of magnitude, on the other hand, incorporates distance. The apparent magnitude is a measure of the diminishing(decrease) flux of light as a result of distance according to the inverse-square law.
What is RNA and list and explain the 3 different types of RNA.
Answer:
RNA is Ribonucleic acid
mRNA
rRNA
tRNA,
Explanation:
mRNA, or messenger RNA, that serve as temporary copies of the information found in DNA; rRNA, or ribosomal RNA, that serve as structural components of protein-making structures known as ribosomes; and finally, tRNA, or transfer RNA, that ferry amino acids to the ribosome to be assembled
hey can you help me with some questions
Answer: i need this answer also
Explanation:
Which of the following measurements is the most precise?
165mg
O 164.5mg
164.47mg
Answer:
164.47mg
Explanation:
Precise means the most accurate
Which process connects glycolysis and the citric acid cycle?
A)lactic acid formation
B)acetyl COA formation
C)electron transport
D)Krebs cycle
Answer:
b
Explanation:
because my maam said this same question in grade 7
The process of making proteins is called
Answer:
translation
Explanation:
Answer:
Translation
Explanation:
Find the difference between testosterone and the steroid molecule.
Brainliest!
Answer:
It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.
Explanation:
does this help :)
science is so confusing to me!
Select all answers that are correct.
If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:
the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself
Answer:
second one.
Explanation:
not sure but it's the only answer that goes with the other laws
PLS I need someone to upload a photo of the answer!
Answer:
See the file bellow
Explanation:
if you climbed up a hill,which of these statements would be true
Answer:
A. your weight would increase because you're farther away from Earth's center
Explanation:
honestly I'm guessing
let me know if this helps
Can dependent variables be manipulated?
Answer:
The Dependent and Independent Variables
The independent variable is the variable that is controlled and manipulated by the experimenter. ... The dependent variable is the variable that is measured by the experimenter. In our previous example, the scores on the test performance measure would be the dependent variable. Hope this helps leave heart c:
Which is true about all unicellular and multicellular organisms?
O They are made of one cell.
O They reproduce.
They cause infections.
O They are made of multiple cells.