Which of the following is true about Meiosis II?
a) It results in cell death

b) It is like mitosis but all chromosomes are in tetrads

c) It is just like Meiosis I

d) it is just like mitosis but with 2 cells

Answers

Answer 1

Answer:

D.

Explanation:

IM SURE IM CORRECT BECAUSE I TELL MY MOM IF MY ANSWER IS CORRECT!

#carryonlearning


Related Questions

what shape is a leucoplast found in ​

Answers

Answer:

these are colourless plastids found in the storage organs. They are found large numbers in the cells of fruits, seeds, tubers etc.

Explanation:

Answer:

They are found in the storage organs.

Explanation:

hello please help i’ll give brainliest

Answers

Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Explanation:


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Prior to the eruption, Mount St. Helens was a recreation destination in southwest Washington with active fishing, hunting, camping, and hiking. Imagine that you were a U.S. Forest Service officer during this time. What restrictions, if any, would you have placed on these activities during the recovery period to protect the ecosystem

Answers

Answer:

No fishing and hunting.

Explanation:

No fishing and hunting is banned in the Mount St. Helens in order to protect the ecosystem. The banning and restriction on these activities will leads to recovery of the ecosystem. Camping and hiking will be allowed because it can't affect fish and other animals in the ecosystem. So I was a U.S. Forest Service officer, I will ban fishing and hunting in the  Mount St. Helens to protect animals in the recovery period.

Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1–2 sentences.(2 points)

Answers

Answer:

It could help them understand what ancestors they came from and what species they are most related to.

Explanation:

What types of change can mutations have?

Answers

Answer:

Explanation:

Base Substitutions. Single base substitutions are called point mutations, recall the point mutation Glu -----> Val which causes sickle-cell disease.

Answer:

Types of Mutations

Missense mutation: This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by ...

Nonsense mutation: A nonsense mutation is also a change in one DNA base pair. ...

Insertion or Deletion: An insertion changes the number of DNA bases in a gene by adding a piece of DNA.

Explanation:

Which of the following is not a concern about nuclear energy?

Answers

Nuclear energy produces less carbon than fossil fuels

Food chains and food webs show how producers, consumers, an decomposers are connected to
one another as chemical energy flows through different
in an ecosystem
a. energy pyramids
b. trophic levels
c.biospheres
d. abiotic components
HELP WILL MARK BRAINLIST

Answers

Answer:

The correct answer is Choice B.

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

Food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem.

A food web is a complex diagram that exhibits all of the food chains in a given ecosystem.

A food chain is a diagram that represents the transference of matter and energy (as food) from different trophic levels.

A trophic level is defined as a group of organisms in the ecosystem found at the same level in the food chain.

Producer organisms (e.g., plants and algae) are organisms that synthesize their own food.

Consumers (e.g., herbivores and carnivores) are organisms that need to eat organisms from a different population to survive.

Decomposers (eg. bacteria and fungi) are organisms that carry out the process of decomposition by eating dead plants and animals.

In conclusion, food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem (Option B is correct).

Learn more in:

https://brainly.com/question/13267087?referrer=searchResults

PLs, help me with this biology question, please! (I will mark brainliest)

Answers

Answer:

guc is Val = valine

aca is thr =threonine

aug is Met = methionine

uca is Ser = serine

Explanation:

hope this helps

Please help me with this!!

1. Which process plays a part in genetic recombination? A. Asexual reproduction. B. Cytokines. C. Independent assortment. D. Mitotic division.

2. Which correctly lists the following terms in order from smallest to largest? DNA, chromatin, chromosomes, nucleosomes.
A. Chromatin, DNA, Chromatin, nucleosomes
B. Chromosomes,DNA, Chromatin, nucleosomes
C.DNA, nucleosomes, chromatin, chromosomes
D. Nucleosomes, DNA, chromatin, chromosomes

3. In a triploid organism, how many alleles are present for each gene per cell?
A. 1
B. 3
C. 6
D. 9

Answers

I) Independent assortment.

II) Nucleosomes, DNA, chromatin, chromosomes.

III) 3.

EXPLANATION:

Recombination scrambles pieces of maternal and paternal genes, which ensures that genes assort independently from one another.

➻ We know that Chromatin is a complex of DNA and proteins that forms chromosomes. Chromatin looks like beads on a string. The beads are called nucleosomes. Each nucleosome is composed of DNA.

Triploids with three different alleles can easily be detected because they have a unique phenotype.

The process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene.

In independent assortment, different gene variants or 'alleles' are independently and randomly assorted into daughter cells, which allows genetic recombination.

In eukaryotic organisms, DNA is associated with histone proteins in order to form nucleosomes, which arrange in higher organization structures called chromatin fibers.

Subsequently, chromatin fibers condense to form structures called chromosomes.

A triploid organism (3n) contains three sets of homo-logous chromosomes, each one containing one allele for a given locus.

In conclusion, the process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene per cell.

Learn more in:

https://brainly.com/question/10118000

The sequence below represents one side of a DNA strand.
GAA TTC GCA
What would the complimentary DNA strand be during the process of DNA replication?

CUU AAG CGU

GAA CCT CAT

CTT AAG CGT

GAA TTC GCA

Answers

Answer:

GAA TTC GCA    Original strand

CTT AAG CGT    Complimentary strand

Explanation:

The original strand is already given.  It is GAA TTC GCA

Now we need to recognize the complementary strand from the pool of options and pair their bases. Names are written with their letters.

Nitrogenated bases that form nucleic acids correspond to purines and pyrimidines.

Adenine (A) and guanine (G) derive from purines, Thymine (T) and Cytosine (C) derive from Pyrimidines.  

In the DNA molecule, Adenine (Purine) forms pairs with Timine (Pyrimidine), while Guanine (Purin) pairs with Cytosine. Two hydrogen bonds join the A-T pair, and three hydrogen bonds join the G-C.

Knowing this, we need to find the correct option, which will pair A with T and C with G.

1st Strand → CUU AAG CGU → You can eliminate this option because it includes Uracil, which is a base of RNA. Uracil complements with Adenine, but only in RNA, and now we are looking for a DNA complementary strand.2nd Strand → GAA CCT CAT → None of the triplets pair correctly the original strand. It is not complementary4rth Strand  → GAA TTC GCA  → This is equal to the original strand. It does not complement it. 3rd Strand → CTT AAG CGT → The three triples complement the ones of the original strand. This is the correct option.

GC

A T

AT

T A

TA

C G

GC

C G

AT

what are the 3 ways a species can become isolated and form new species? define what each of them mean.

Answers

Answer:

behavioral isolation, geographic isolation, and temporal isolation

Please help!!!!!!!

1. Which data shows that Neanderthals are not the ancestors of modern humans?
A.Differences in Neanderthals and human DNA.
B.Evidence from Neanderthals burial grounds
C.Muscular build of Neanderthals as compared to humans
D.Patterns of Neanderthal extinction.

2. Which mammal is most closely related to bats (chiropterans)
A. Carnivorans
B. Xernarthans
C. Primates
D. Rodentains

3. Which radioactive isotope would be used to determine the specific age of a Paleozoic rock formation?
A. Beryllium-10(1.5 million years)
B. Carbon-14(5715 years)
C. Thorium-232(14 billion years)
D. Uranium-235(704 million years)

4. According to the Hardy- Weinberg principle, which situation would disrupt genetic equilibrium?

A. A large pop of deer inhabits a forest region.
B. A particular pop of flies mates randomly.
C. A pop of flowering plants always has the same group of natural predators.
D. A small pop of birds colonizes a new island.

5. According to the endosymbiont theory, which part of the eukaryotic cell evolved from a prokaryotic cell?
A. Chloroplast
B. Golgi apparatus
C. Nuclease
D. Ribosome

Answers

Answer:

C. Muscular build of Neanderthals as compared to humans

D. Rodentains

A. Beryllium-10(1.5 million years)

D. A small pop of birds colonizes a new island.

B. Golgi apparatus

What can be a recessive or dominat??

Answers

alleles, or genes i think

Answer: There are many examples of recessive traits in non-human animals as well. In dogs, traits like yellow fur, white spots, and smooth hair are recessive. In cats, white fur, brown (as opposed to black) fur, and long hair are recessive traits. In sheep, black wool and blue eyes are recessive.

Also Dominant refers to the relationship between two versions of a gene. Individuals receive two versions of each gene, known as alleles, from each parent. If the alleles of a gene are different, one allele will be expressed; it is the dominant gene. The effect of the other allele, called recessive, is masked.

There are many examples of recessive traits in non-human animals as well. In dogs, traits like yellow fur, white spots, and smooth hair are recessive. In cats, white fur, brown (as opposed to black) fur, and long hair are recessive traits. In sheep, black wool and blue eyes are recessive.

Hope this helps

suggest how the liver will metabolism alcohol when a person consumes red wine .

Answers

Most alcohol is broken down, or metabolised, by an enzyme in your liver cells known as alcohol dehydrogenase (ADH).ADH breaks down alcohol into acetaldehyde, and then another enzyme, aldehyde dehydrogenase (ALDH), rapidly breaks down acetaldehyde into acetate.

may be useful

why large spaces present between
spongy mesophyll cells​

Answers

These large spaces allow these layers to help carbon dioxide move around the leaf. The spongy mesophyll also allows the plant to bend and move in the wind, which itself helps move gases around the leaf's cells.

Como se chama a transferencia de enrgia termica flui de um corpo com maior temperatura quando ao outro de menor temperatura quando ha diferença de temperatura entre ambos

Answers

Answer:

Conduction.

Explanation:

Conduction is the process in which heat energy is transferred from the hotter body towards colder body because of temperature difference between two bodies. Conduction occurs only due to physical contact between two bodies. In the conduction process, the thermal energy flows from a body with a higher temperature to the other body having lower temperature until both bodies having same temperature.

If a gene has only one allele, how many different traits can the allele produce?
A. 2
B. 1
C. 3
D.O
PLEASE ANSWER 50 POINTS!

Answers

Answer:

B) an allele is a form of a gene. If there is only 1 allele, there is only 1 phenotype.

Explanation:

If air pollution causes the rain that falls on this pond to become much more acidic after two years how will this acidity
affect the living things in this pond?
There will be more plants and animals because the acid will kill most of the disease causing microorganisms
There will be more plants and animals because the acid is a source of food,
There will be fewer plants and animals because many of them cannot survive in water with high acidity,
D There will fewer plants and animals because the acid will dissolve many of them,

Answers

Answer:

the guy above me is correct

Explanation:

I know this isn't a explanation so I don't really know why I am putting it under the explanation category but I am really sorry if it is wrong

I've been looking around for the answer in this interactive website that was included within to answer these questions but, I couldn't find it and I'm wasting time looking for it.

Answers

Answer:

Iron is what mercury is mostly made of

‼️‼️‼️
PLEASE HELP WILL GIVE BRIANLIEST :))

Answers

Answer:

J SHAPED CURVE GIRL

Explanation:

HOPE THAT HELPS MUAH!

“When graphed, it appears as a J-shaped curve”, and “it occurs under ideal conditions with unlimited resources”

What will most likely happen in the absence of a vacuole?

Photosynthesis will not take place.
Genetic information will not be transmitted by the cell.
Energy will not be released during cellular respiration.
The cell will not store food, water, nutrients, and waste.

Answers

Answer:

The cell will not store food, water, nutrients and waste

Explanation:

Photosynthesis is chloroplast

Genetic information is nucleus

Energy is mitochondria

Vacuole contain water, organic acids, sugars, amino acids, enzymes, mineral salts, oxygen, carbon dioxide and metabolic by-products

Answer:

D. The cell will not store food water nutrients and waste

Explanation:

Consider the satellite images that show topographical maps of Greece before and after fires of 2007. Imagine it is ten years
later.
Which prediction would not be consistent with a third satellite image of the area ten years in the future.
es )

Answers

Answer:

B) Ten years in  the future, that should be little or no change in the satellite  image that we will see

Explanation:

Its on usa test prep and I got it right

The prediction that would not be consistent with a third satellite image of the area ten years in the future is little or no change will occur.

What do you mean by Topographical maps?

Topographical maps may be defined as complicated, accurate graphic representations of features that appear on the Earth's surface.

Every year shows a drastic change in the topographical maps through satellites. It can be said that a period of ten years completely changes the whole sequence and positioning of lives living in a particular area.

Apart from geographical locations, technological advancements, climatic factors, and species may also alter.

Therefore,  the prediction that would not be consistent with a third satellite image of the area ten years in the future is little or no change will occur.

The satellite that detects the views of topographical maps is picturized below:

To learn more about Topographical maps, refer to the link:

https://brainly.com/question/1026002

#SPJ2

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called . When a population is severely reduced by an environmental disaster such as a fire, the result is a due to the reduced genetic diversity of the survivors. 3. The can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Answers

Answer:

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called Genetic drift.

When a population is severely reduced by an environmental disaster such as a fire, the result is a Bottleneck effect due to the reduced genetic diversity of the survivors.

The Founder effect can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Explanation:

Genetic drift is an evolutive force. It is the random change that occurs in the allelic frequency of a population through generations. Its effects are harder in a small-sized population, meaning that the magnitude of this change is inversely related to the size of the original population.  

Genetic drift results in some alleles loss -including the beneficial ones-, while some other alleles get fixated. Low-frequency alleles are the most likely to be lost. The changes produced by genetic drift accumulate in time and results in a loss of genetic variability within a population.  

Genetic drift affects a population and reduces its size dramatically due to a disaster or pressure -bottleneck effect- or because of a population split -founder effect-. The bottleneck effect most likely affects smaller populations.  

The bottleneck effect -a case of genetic drift-, mostly affects smaller populations after the occurrence of a natural disaster or some human action -such as extensive hunting, for instance-. These events might act as a pressure that reduces significantly the number of individuals in a population. In these situations, some alleles are lost, and the survivors have a different genetic charge than the one of the original population. There might be a reduced genetic variability, with a possibility of developing a peculiar allelic component. If the survivors in the population carried or developed a mutation, probably this mutation passed from generation to generation.  

Founder effect refers to the origin of a new population from only a few individuals that are coming from a bigger-sized population. These founder individuals, which are carrying some of the genes of the original population, settle down in a new area and reproduce.  The new and small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be lost by complete. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced, and there exists the possibility of developing a peculiar allelic composition. When the number of individuals that originated the new population is low, the founder effect will be very extreme because the genetic drift effects are inversely proportional to the original number of individuals.

The number of worldwide standard time zones is
*
15
30
12
24

Answers

Answer:

24

Explanation:

What is the advantage and disadvantage of drug abuse​

Answers

there are danger and you call someone to help you

Does light have an effect on carbon dioxide production by plants and animals?

(No Links!! type the answer)

Answers

answer:

Light provides the energy for photosynthetic pig- ments to convert carbon dioxide (CO2) and water into sugars and oxygen. As light intensity increases – until a point – the amount of sugars increases and thus, more energy is available for plant growth and maintenance. hope this helps :D


Inherited traits are:
A Dependent on diet
B Acquired during an organism's life
C Free of mutations
D Passed on from parent to offspring

Answers

Answer:

d

Explanation:

The answer is D



Skeiwiw88Sksk’s ...................makes

The genetic composition of an organism is called the

Answers

Answer:

The genetic composition of an organism is called the genotype.

The deadliest of all mass extinctions, which killed 95% of all living organisms, was the
• Cretaceous-Tertiary

End Triassic
Jo

Permian-Triassic

Late Devonian
• Ordovician-Silurian

Answers

Permian-Triassic is the answer

Other Questions
If your e-mail program has a spell checker, you don't have to proofread your e-mail messages. Spell checker does it for you and is better at it than humans.TrueFalse Plz help!!! Image!!!!!!!! I need this because if I get these right I will bring m grade up to a c High-tech sector employmentin 2004.In the future, high-tech sector employment is expectedtov employment in the privatesector.ctor The manufacturing ability of the U.S. turned the tide of the war. What group, in particular, allowed U.S. manufacturing to be so extensive? what does el nino no tiene classes mean in english pls help i have a quiz tmrw PLEASE HELP! Don't know what they want me to do!Copy and paste the most recent draft of your reflective essay below this prompt. Then, revise your essay by adding transitional tags to improve the flow and coherence of your thoughts. Boldface any changes or additions you make. cyberbullyingheNTRODUCTION1. Define the following terms1.1. Social media platform1.2. Cyber bullying Can someone plz help me with this percentage problem!!! Por qu en la moda de Espaa predomina el color negro? 1) A traditional die is a cube with each of its six sides representing the numbers from 1 to 6. Mr. Dicey customized a die by replacing each number with its reciprocal (reciprocal of x is 1/x ). What is the expected value if you roll the customized die for 6 times? 2) A game is played by throwing 3 dice. You will win in this game if the summation of the scores of these 3 dice is 3, 4, 17, 18.What is the variance of your expected values?3) Two dice are rolled. [A die has six sides, each representing the score from 1 to 6]What is the expected value if you roll these two dice for 6 times? put into algebraic expression and then Coefficient/Variable1. 5 less than x is 20 2. the sum of x and twice y equals -63. the product of 5 and x squared results in 12 I really need helpp Which solution will provide the LOWEST freezing point? Group of answer choices 1.2 M MgCl2 1.60 M KI 1.0 M Na2CO3 1.5 M NaCl I AM GIVING OUT BRAINELST which Revolution was most successful French revolution, American revolution, or the Haitian revolution? explain 4. Super Smarts University has a sticker price of $45,000 per year. Kyle is applying there and uses their online netprice calculator, which calculates a net price of $38,000 per year based on the information he is provided. He's#1 in his high school class, and he's got great SAT scores; so he's pretty sure he'll get in. How much will Kyle payto attend?The exact net priceb. Within a range of $5000 of the sticker price$0, because he'll likely get a full ride due to his high school achievements and scoresd. It's impossible to know how much he'll pay until he receives his financial aid packagea.C. Apache and Navajo arrived in New Mexico around The table below shows the ages of employees under 30 at a company and their annual salaries. (NOOOOOOOOOOOOOO LIIIIIIIIIIIIIIINKS!!!!!!!!!)Fill in the missing digits: _37_ minus 2465 = 59_7I REPEAT, NO LINKS!