Which of the following events resulted in the Battle of Honey Springs?
A. The Confederates attempted to capture a Union supply train.
B. The Confederates attempted to reclaim Fort Gibson.
C. The Unionists attempted to divide the American Indian regiment.
D. The Unionists attempted to round up American Indian refugees.

PLZZ HURRY

Answers

Answer 1

Answer:

B.

The Confederates attempted to reclaim Fort Gibson.

Answer 2

Answer:

B. The Confederates attempted to reclaim Fort Gibson.

Explanation:

I just took the quiz and got it right


Related Questions

During the American Revolution, which colonial officer plotted to surrender the colonial fort at West Point to the British?
General George Washington
Captain John Paul Jones
Marquis de Lafayette
General Benedict Arnold

Answers

Answer:He was a delegate from Virginia at the Second Continental Congress and wrote the Declaration of Independence. He later served as the third President of the United States.

Explanation:

Answer:

its D) General Benedict Arnold

Explanation:

i just took the unit review

What impact did Fascist politics have on World War II?

Answers

A lot. It led right to it. And at the time, people were convinced (with some good reasons) to believe that communist were the main threat to Europe.

Fascism was seen as a necessary evil. But evil remains evil. It was in fact the most aggressive of the two.

So fascism seeded the war, prepared the related people to support the war, and then dictated the conduct of the war by the Nazi Germans and Mussolini’s Italia in Europe. Japan has somehow its own variant with its cultural specificities, the Statism / Showa nationalism, which led to the same kind of atrocities that were then perpetuated in Europe.
2.8K viewsView 8 Upvoters
Related Questions (More Answers Below)

The expeditions to the New World were all successful.

T
F

Answers

Answer: False

There were some expeditions that failed, and brought no information or land. So, the answer should be False.

Hope it helps!

Answer: false

Explanation: i had just taken the quiz on edg, and i hope this helps

What was the quickest and most efficient way for Spain to grow its wealth in the Americas?
A. holding captives for high ransom
B. stealing American Indian artifacts
C. securing land and charging high taxes
D. finding treasure, mostly in the form of gold

Answers

Answer:

A, holding captives for high ransom

Explanation:

Spain took the leader from the Aztecs, and killed lots of people, making people fear them.

Answer:

A

Explanation:

Why is Christopher Columbus controversial?

Answers

Answer:

because he didnt discover america, he took the credit just because hes the 2nd person who went there

Explanation:

Because he claimed he discovered America when he didn’t and people were very angry with him

Napoleon named himself of France * A: King B: Emperor C: Coup d' etat D: General​

Answers

c emperor

Explanation:

Image result for Napoleon named himself of what France

Author of Les Révolutions, 1770–1799; Napoléon; and others. Napoleon I, French in full Napoléon Bonaparte, original Italian Napoleone Buonaparte, byname the Corsican or the Little Corporal, French byname Le Corse or Le Petit Caporal, (born August 15, 1769, Ajaccio, Corsica—died May 5, 1821, St

He called himself Emperor of France.

WELPPPPPPPPPPPPPPPHELPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!!!!!!!!!!!
If you had lived at this time; how would you have dealt with the Native Americans? What would you have done differently and what would you have done the same? Please be specific and detailed in your response.

Answers

Answer:

Native Americans learned to use natural resources in their environments for food, clothing, and shelter. For example, in the frigid regions of the far north, early Americans survived by hunting caribou in the summer and sea mammals in the winter.

The buffalo was the most important natural resource of the Plains Indians. The Plains Indians were hunters. They hunted many kinds of animals, but it was the buffalo that provided them with all of their basic needs: food, clothing, and shelter.

Typically, Tribal and Federal governments are the largest employers on the reservations. Many households are overcrowded and earn only social security, disability or veteran's income. The scarcity of jobs and lack of economic opportunity mean that, depending on the reservation, four to eight out of ten adults on reservations are unemployed. Among American Indians who are employed, many are earning below poverty wages (2005 BIA American Indian Population & Labor Force Report).

The overall percentage of American Indians living below the federal poverty line is 28.2% (2008, American Indians Census Facts). The disparity for American Indians living below poverty on the reservations is even greater, reaching 38% to 63% in our service area (2006, National Center for Education Statistics, and other sources).

Often, heads of household are forced to leave the reservation to seek work, and grandparents take on the role of raising their grandchildren. In order to survive, extended families pool their meager resources as a way to meet basic needs. The relative poverty still experienced by these blended families is best understood as the gap between the overall need and the need that goes unmet.

Explanation:

why did the farmers have a problem with banks

Answers

Answer:

A major problem faced by American farmers was mortgage foreclosure. Unable to make the monthly payments, many farmers were losing their property to their banks. The Frazier-Lemke Farm Bankruptcy Act allowed any farmer to buy back a lost farm at a law price over six years at only one percent interest.

Explanation:

The excerpt suggests that as of European colonization American Indians have Thou reproachest us, very inappropriately, that our country is a little hell in contrast with France, which thou comparest to a terrestrial Paradise, inasmuch as it yields thee, so thou sayest, every kind of provision in abundance. Thou sayest of us also that we are the most miserable and most unhappy of all menliving without religionwithout manners , without honour without social order , andin a word, without any rules like the beasts in our woods and our forests lacking bread, wine, and a thousand other comforts which thou hast in superfluity in Europe . Micmac Responds to the French " learned about the shortcomings of own cultures become dependent on goods imported from Europe grown resentful of the presence of European settlers accepted the presence of European settlers

Answers

Answer:

If this is the one written by –"A Micmac Responds to the French” The answer is C

Explanation:

Got it right on edg 2020

Give the social dimension of the Paschal Mystery?

Answers

Explanation:

in my opinion the social dimension of the Pascal mystery is by Respecting life of every individual,having respect for the dignity of everyone,sharing materials and food and protecting essential rights just as Christ did for everyone

(Thanks and sorry)

True faith always has a social dimension.

What reason do historians give for a decline in the status of women after the Neolithic Revolution?
This is a free response question. Please help ASAP!!

Answers

Answer:

Women lost social standing and freedom

Explanation:

Which of these is an example of muckraking disguised as a work of fiction?
A: A Century of Dishonor and Ramona by Helen Hunt Jackson
B: The History of the Standard Oil Company by Ida Tarbell
C: The Octopus by Frank Norris
D: The Red Record by Ida B. Wells

Answers

Answer:

C

Explanation:

Answer: C.) the octopus by Frank Norris

Explanation:

Witch interaction contributes to the greenhouse effect

Answers

Answer:

A

Explanation:

How does Hammurabi’s Code reference the Euphrates River?

It says that people could only own property east of the river.
It says that people could apply to be married down by the river’s banks.
It says that people could be given money if the river flooded their farmland.
It says that people could be made to jump in the river to determine their guilt or innocence.

Answers

Answer:

either C or D

Explanation:

It says that people could be given money if the river flooded their farmland. It says that people could be made to jump in the river to determine their guilt or innocence.

Answer: D it says that people could be made to jump in the river to determine their guilt or innocence

Explanation:I just did this

Hope this helps!

Which king was excommunicated from the church for arguing with Pope Gregory VII?


King Henry IV

King Edward

King William I

King Harold

Answers

Answer:

King Henry IV

Explanation: Gregory first excommunicated Henry IV, head of the holy Roman empire, from the Roman Catholic church because he had gone back on his word and refused to follow the Pope's orders.

Answer:

It's B cause

Explanation:

I was on test and it was right

Quiz: European Monarchs

12/31/2020 Edg.enuity

Help with history please due today!!!

Answers

Answer:

hljyxix

Judy

uyuyyiriyd5hwkj75dywou5suyyiriyd5hwkj75dywou5sthwm.rywkktygsomt

Under the system of mercantilism, the American colonies served all of the following primary roles
EXCEPT
A)
as a source of raw materials for European nations
B)
as a source of labor for major European industries
as a source of income for European manufacturers
D)
as a source of tax revenue for European nations

Answers

I believe the answer is B

Under the system of mercantilism, the American colonies served all of the following primary roles EXCEPT as a source of labor for major European industries. Thus the correct answer is B.

What is mercantilism?

Governments employed their industries to ’s biggest power at the expense of other nations during the period of mercantilism.

Its objective is to balance an economy's imported and exported goods to the highest degree possible. In order to accomplish the goal, it encourages colonialism, tariffs,  as well as traded goods subsidies.

The American colonies provided as a raw material supply for European countries under the international trading regime. It also provides income and tax revenue for European firms.

Therefore, option B as a source of labor for major European industries is appropriate.

Learn more about mercantilism, here:

https://brainly.com/question/11353357

#SPJ2

Select the correct answer.
In which form of government is power is passed down from generation to generation?
OA monarchy
OB. socialism
OC. democracy
OD.
communism
Reset
Next
Edmentum. All rights reserved.


Answers

Answer:

A: monarchy

Explanation:

the power is passed down to relatives of the ruler

In a monarchy form of government, power is passed down from generation to generation. The correct option is A.

Power normally passes down within a royal or ruling family in a monarchy from generation to generation. The head of state, also referred to as a king, has the highest authority and frequently succeeds to it by hereditary succession. Examples of monarchy include constitutional monarchies, in which the ruler's authority is constrained by a written constitution, and absolute monarchies, in which the ruler has unrestrained power.

Thus, the ideal selection is option A.

Learn more about monarchy government here:

https://brainly.com/question/30711729

#SPJ7

When was the rosetta stone found and made?

Answers

It was found in 196 b.c and was made in Egypt

Answer:July 19,1799 found in a near town 35 miles east of Alexandria

Directions: Read each scenario below. Explain how and why one scenario is a violation of free speech and
why the other scenario is not a violation of free speech.
Scenario 1:
Today Jerome got paid. While walking home from his job, he sees a sign in the Vans shoe store advertising
their new shoes. The following was written on the sign:
"Purchase our new SK8 shoes. No tears, rips, or holes, for at least 9 months."
Jerome enters the Vans store and purchases the "Sk8 shoes." 3 Months later Jerome notices two new holes
in his Sk8 shoes.
Did the Vans store violate their freedom of speech?
Scenario 2:
Walking home from school you encounter a group of students who are standing on the corner discussing
their views on immigration. They invite you to join the group and you accept. As the group continues to
discuss their views, one student named Daniel says the following:
"I don't think they should let anyone into our country who is not Christian. This is a country that was
founded on Christian ideas, and if your not a Christian, then there is no way you can live here. They will ruin
our country."
Did Daniel abuse his freedom of speech?

Answers

Answer:

For scenario one is no because the can show store said in a few months they are gonna destroy they gave you a warning before buying it. yes for number 2 because he was invited to the group to share his reasons but he went to far he said only Christians.

What was the agricultural revolution?​

Answers

Answer:

The Agricultural Revolution was a period of time where humans were first discovering to have some control over their enviroments!  They irrigated and farmed! Inventions such as the plow and wheel came about, civilizations started to have large food surpluses unlike hunting and gathering communities!! They used rivers to their advantage, and invented many clever things!! ~ Feel free to mark BRAINLIEST!!~

from what source does the national government get most of its revenue?

Answers

The three main sources of federal tax revenue are individual income taxes, payroll taxes, and corporate income taxes. Other sources of tax revenue include excise taxes, the estate tax, and other taxes and fees

Why were colonial women
important in the work force?

Answers

Answer:

colonial women were important in the work forcew becuase when men went to war there was no one to help build the planes and stuff like that so they got jobs in the factories to helop build the planes

Explanation:

Which accurately describes the Bonnet Carré Spillway?
0 It is made of a series of small lakes.
It is mostly preserved wetlands.
o It borders the ocean.
0 It contains miles of guide levees.

Answers

Answer:

The answer is D: It contains miles of guide levees.

Explanation:

I just took the Unit Test Review thing.

Answer:

d

Explanation:

Traditionalists responded to plans for assimilation by __________.

A.
working to keep old ways of life
B.
joining settlers’ churches and faiths
C.
creating written languages
D.
using the government’s currency

Answers

A. working to keep old ways of life

Answer:

A. working to keep old ways of life

Explanation:

Why did La Salle establish the colony of Fort St. Louis? He was unable to find the mouth of the Mississippi River again to establish territory in Louisiana. He was denied royal sponsorship by the king of France to colonize the Louisiana region. He found the ground near Fort Maurepas to be too difficult for farming or raising animals. He failed to establish good relationships with American Indians elsewhere in North America.

Answers

Answer: He was unable to find the mouth of the Mississippi River again to establish territory in Louisiana.

Explanation:

Answer:

a

Explanation:

How many languages are there? What did the first language sound like?

Answers

Answer:

there are about 6,500 languages and the first language was technialy

cave man so it didnt really soudn like anything

Explanation:

6,500 languages, chanting and animal-like noises

10 example of sensory language in the story eleven by sandra cisneros

Answers

Answer:

yes yes sandra cisneros very good england

Explanation:

Which statement correctly describes brahmanism

Answers

Answer: the answer is C

Explanation: took the quiz on edge sorry if im real late <3

Answer:c

Explanation: also I asked dark vader he said yes and my friends

It's right

Which group was more likely to look for new forms of entertainment?
- The Lower Class
- The Working Class
- The Middle Class
- The Poor Class
(I'm specifically looking for the Apex Learning answer if anyone can help me)

Answers

Answer:

Middle class.

Explanation:

Middle class has more money and free time than the others.

Other Questions
In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change? can you plzzzzzzzzzzzz help me What is 6/20 of a dollar BRAINLIEST IS RIGHT WILL BE MARKED BRAINLIEST AND PLUS 12 POINTS Which detail from the passage best explain why plants photosynthesize? Let S = {1, 2, 3, 4, 5, 6, 7, 8, 9), A = { 1, 2, 3, 4, B= {2, 4, 6, 8} andC= {3, 4, 5, 6). Find (i) A (ii) An C (iii) (An CY (iv) A UB (V) BIC What is the slope of the line that passes through the points (3,5) and ( 1, 5)? Write your answer in simplest form. Which choice shows the correct sequence or order of events for a scientific experiment?A) Perform experiment -> Form hypothesis -> Analyze data -> Draw conclusions B) Analyze data -> Form hypothesis -> Perform experiment -> Draw conclusions C) Perform experiment -> Analyze data -> Draw conclusions -> Form hypothesis D) Form hypothesis -> Perform experiment -> Analyze data -> Draw conclusions What is the value of the expression below when x=8? 10x+5 your sick grandma has been admitted at the hospital.write a letter to your brother describing the state of her health when u visited her.