Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Answer 1
Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

Related Questions

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

For each sequence of DNA is shown. Write the complementary RNA sequence underneath the letters, then use the codon chart to determine the amino acid sequence. DNA: TTC AAT GGT CTA GGG

Answers

DNA: TTC. AAT. GGT. CTA. GGG
Com RNA: AAC UUA CCA GAU CCC
Amino Acid: (ASN) (LEU) (PRO) (ASP) (PRO)

Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biomolecules. The picture
above shows an example of this. Examine the model and choose ALL of the statements that accurately describe the formation of the
new biomolecule.
A)
Proteins are being formed.
B)
The monomers are amino acids.
o
This is a hydrolysis reaction.
D)
Carbohydrates are being broken down.
E)
This is a dehydration synthesis reaction

Answers

B- the monomers are amino acids had the answer key last year

The following statements are true from the image;

Proteins are being formed.The monomer, are amino acids.

Many biomolecules are naturally occurring polymer substances. In this case the biomolecule that is being formed is a protein.

A protein is composed of several peptide bonds formed from amino acids. Hence, the monomer in this case are amino acids from which polypetides and proteins are formed.

Learn more: https://brainly.com/question/1443134

List one organism and describe all of its adaptations.​

Answers

Adaptation is a mechanism of species to survive and reproduce in their environments, adjusting to selective pressures. Cactus: leaves, stems, spines.

What is adaptation?

In biology, adaptation might be defined as the mechanism of organisms to improve their fitness in the environment in which they live, adjusting to different changes and selective pressures acting on them.

Adaptation involves molecular, physiological, morphological, and behavioral changes.

For these changes to persist and be transmitted from generation to generation, they must increase the individual's fitness. They must increase the individual survival and reproductive probabilities, making it more competitive.

A good and easy to unsderstand example of adaptation is the cactus.

Cactusses are plants adapted to dry and hot environments like deserts, where water availability is scarse and temperatures are high.

To avoid dehydration, cactusses have developed wide palmated or cilindirical stems and reduced or vestigial leaves.

They use stem tissues to store water. Vestigial or reduced leaves to avoid transpiration and water loss.

As their leaves are not developed, their stems photosynthetize to produce organic compounds.

Some species are very rich in water and nutrients, so they turn to be covetted by other species. Animals living in the same environment look for them as a source of food.

To avoid predation, cactusses have developed large and numeros spines that are leaves modifications. This is another adaptation to avoid being eaten by animals and avoid loosing water through leaves.

You can learn more about adaptations at

https://brainly.com/question/14420984

how does pollution travel from a river to the ocean?

a) pollution flows upstream toward the ocean

b) pollution flows downstream toward the ocean

c) pollution flows toward the bank of a river and then to the ocean

d) pollution flows toward the source of a river

Answers

Answer:

d

Explanation:

I would say d, because the other guy said d


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

does having a lower than normal thyroid hormone level affect oxygen consumption ​

Answers

Answer:

yes

Explanation:

and hope this helps byee

What happens to the distance between waves Wave lengths 

Answers

Not sure but hope you find the answer

Babies with very low or very high birth weight are less likely to survive. The graph shows the percentage of babies born at different weights.

A graph entitled Percentage of Babies born at Different Weights has weight in pounds on the horizontal axis, and percentage on the vertical axis. A small percentage of babies are born at the low and higher birth weights, and a greater amount are around 7 to 8 pounds.

Which statement is a valid claim that could be made using the data in the graph?
Directional selection is occurring because the graph favors an extreme.
Stabilizing selection is occurring because the average is favored.
Disruptive selection is occurring because the two extremes are favored.
Biodiversity variation is occurring because there is an increase in trait variation.

Answers

Answer:

C

Explanation:

Otherwise people wouldn’t have differences

Answer:

C!!! :))

Explanation:

I tookt the test and got it right.

Which of the following distinguishes the relationship between a taxon and taxonomy?
A taxon is an anomaly in the classification system known as taxonomy.

B taxon is a level of the classification system known as taxonomy.

C taxon is a specific trait in the classification system known as taxonomy.

D taxon is an unknown factor in the classification system known as taxonomy.​

Answers

Answer:

B taxon is a level of the classification system known as taxonomy.

Hope this helps!

HELP PLEASE I WILL GIVE YOU THE BRAINLIEST

Answers

Answer: the answer should be C)Modles can not account for ever factor that may suddenly  change.

<sorry if it’s wrong>

pasteurization is not required for which type of egg or egg product​

Answers

Answer:

whole eggs

Explanation:

i think its whole eggs but there is a guideline that says all egg products must be pasteurized

Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allow for this action?

A.water has a neutral pH
B.water maintains temperature
C.what expands when it freezes
D.water dissolves many compounds

Answers

Answer:

Water has a neutral pH

Explanation:

None of the others exactly fit in with what this is saying, and water having a neutral pH allows the supplies and nutrients that it carries to stay safe within it throughout the way.

Sorry if this isn't correct or full-fledged explained like I normally do, I saw you said to hurry up and I didn't do my normal research and whatnot.

Anyways, hope this helped!

Sources: N/A

The characteristic of water that allows this process of carrying nutrients and gases is water has a neutral pH. Thus, the correct option for this question is A.

What are the characteristics of water?

The characteristics of water are as follows:

It is a universal solvent. Due to the partial positive charge on hydrogen and partial negative charge on oxygen, it is a polar molecule. It has high heat capacity and high heat of vaporization. It has properties like cohesion and adhesion. Its solid form is less dense as compared to liquid.

Due to having the property of neutral pH, water significantly performs movement across the entire body with the help of blood.

It does not form any barrier with the differences in the level of pH. So, along with blood, water carries nutrients and gases that must be required for proper survival throughout the body.

Therefore, water that has a neutral pH is the characteristic property that allows the carrying of nutrients and gases required for survival throughout the body.

To learn more about The properties of water, refer to the link:

https://brainly.com/question/18681949

#SPJ6

In rabbits, the gene for black fur is dominant over the gene for white fur. How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?

Answers

Answer:

it is going to xx or xy those genes of the father and the father

12 POINTS!!

Semiconductors are materials that conduct electric current better than insulators but not as well as conductors.


Please select the best answer from the choices provided

T
F

Answers

Answer:

True

Explanation:

Hope this helps!

Answer:

True :)

Explanation:

Write a scientific explanation as to “What is the main cause of global warming?"

Answers

Answer:

It is the aspect of climate change

Explanation:

Referring to the long term rise of planet's temperatures,it is caused by increased concentrations of greenhouse gases in atmosphere

Answer:

Excess C02 in the atmosphere caused by coal burning, exhaust, factory smokestacks, and deforestation.

Explanation: i am sorry if this is wrong

Body systems interact with one another to carry out life processes. Movement is an important function in animals. Which body
systems work with the skeletal system to enable voluntary movement of the organism? Choose ALL that apply.
A)
nervous system
B)
muscular system
C)
endocrine system
D)
lymphatic system
E)
circulatory system

Answers

A because the nervous system si the guy who helps ur body

Answer:

B

Explanation:

Because it's the muscle helps the body system with the skeletal system to enable voluntary movement of the organism

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated

Answers

Answer:

I'm going to say A

Explanation:

because it just make more sense

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

Two different populations of birds live in the same area and eat the same types of food. Which most likely describes the relationship between these two populations of birds?

A. Competition

B. Mutualism

C. parasitism

D. predator-prey

Answers

Answer:

A. Competition

Explanation:

Both species of bird need to compete for limited resources, in this case they need to compete for both territory and food

Answer:

Competition

Explanation:

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

Which best describes the difference between protists that have cilia and those that have flagella?
O Those that have cilia are animal-like protists, and those that have flagella are plant-like protists.
O Those that have flagella are animal-like protists, and those that have cilia are plant-like protists.
Those with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.
Those that have cilia are heterotrophs, and those that have flagella are autotrophs.

Answers

Answer:

C.

Explanation:

Those with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.

Protists that move with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.

What are protists?

Protists are single-celled eukaryotic organisms which are either free-living or parasitic.

Protists include paramecium, euglena, amoeba.

Protists have various structures for movement.

Protists can either no be with pseodupodia, flagella or cilia.

Those with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.

Learn more about protists at: https://brainly.com/question/1300945

Chloroplasts contain ____, a green pigment that absorbs light energy.
A. an ovule

B. photosynthesis

C. a cuticle

D. chlorophyll

Answers

Answer:

d of course is this 7th grade?

Answer:

D. chlorophyll

Explanation:

sana nakatulong

16.2.2 Why is it important to complete a course of antibiotics?

Answers

It's because taking them regularly until the prescription is complete helps ensure that all of the illness-causing bacteria are killed or prevented from multiplying

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

I mark Branliest for the correct answer quickly please listen to me Eyes Blue

Answers

Answer:

1(i think)

Explanation:

The nucleus controls and regulates the activities of the cell (e.g., growth and metabolism) and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.

Other Questions
Which sentence uses a noun clause as a predicate nominative What is the balanced molecular equation and balanced chemical equation for NaSO4 and KNO3? What is a unique polygon? (No links)Pls help me~ history~Ill mark brainliest if correct Calculate the Simpsons diversity index using the information below.A 3 column table with 3 rows. Column 1 is labeled Species with entries American bullfrog, Pool frog, Common toad. Column 2 is labeled Pond 1 with entries 300, 335, 365. Column 3 is labeled Pond 2 with entries 20, 49, 931.What is the Simpsons diversity index for pond 1? Round to the hundredths place. forest plant nurseries will likely work with state and federal agencies What does technology take away from us ? These are the answers:1.I was the news paper advisor for my last school, and there is something powerful about students getting their work published.2.Clubs generally need a teacher to sponsee them. 3.The author suggests that students would benefit from a publishing club. Which question do they match to? Which is the larger value: 2 x 10^6 or 9 x 10^5?Explain how you know. 1. Explain the roles of products, reactants, and limiting reactant in a chemical reaction. for brainiest in 2 minutes Solve the system below. y= -3/4x-42y-2=x Anyone know Spanish 1? I'm in need of help right now Read and contrast two passages about sun safety.Which difference can be found when contrasting thesetwo passages?Passage 1"It is a scientific fact that everyone needs sunscreen,regardless of skin color or ethnic origin. All people aresubject to sun damage."O The first author uses humor to appeal to children.O The second author uses humor to appeal tochildren.Passage 2"No one wants to look like a lizard! You need a bigsquirt of sunscreen before heading outside to play.Sunburns are no fun, so protect yourself."The first author uses scientific facts to appeal tochildren.O The second author uses scientific facts to appeal tochildren. Do you see a trend on this scatter plot ? How much force is needed to keep the bowling ball moving towards the pins once it hasleft the man's hand?PLEASE HELP! pAn office building owner agrees to buy a minimum of 270 chairs and up to 440 chairs from a supplier. The price will be $85 per chair if only 270 chairs are bought, but will be discounted by $0.2 per chair (on the entire order) for every chair ordered in addition to the minimum. Answer the questions below, rounding your answers to the nearest whole dollar. a) What is the largest revenue the supplier can make under this deal I will give brainliest to the person who makes me laugh. :) No links, just funny stuff XD PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER. Your assignment is to discuss in writing at least two techniques you use (or will use or will suggest to others) to help handle mental stress. Include at least two references you use to support your techniques. One reference can be your textbook. **I will do the textbook part**