Which of the following are represented by upper and lowercase letters? A. proteins B. chromosomes C. genotypes D. phenotypes​

Answers

Answer 1

Answer:

Represented by upper and lowercase letters

(C) genotypes

Answer 2

The following are  Represented by upper and lowercase letters are

(C) genotypes. Thus, option "C" is correct.

What is Genotype and phenotype?

Genotype is the genetic makeup of an individual i.e the genes responsible for a traits or character that is expressed in an individual.

Phenotype is the physical expression of a gene. Each gene in an individual that is expressed or can be seen physically is what makes up the phenotype.

Thus, option "C" is correct.

To learn more about Genotype  click here:

https://brainly.com/question/12116830

#SPJ2


Related Questions

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3


Which of the following is a way in which the atmosphere does NOT
interact with the hydrosphere? *
A). Decreasing the salinity of oceans from increased temperatures causing glacial
melting.
B). Developing hurricanes over warm ocean currents.
C).Increasing the amount of water evaporation from oceans and global temperatures
rise.
D). Gases moving sediment from hill tops

Answers

The correct answer is d. Please give me brainlest let me know if it’s correct or not okay thanks bye

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

Other Questions
Read the excerpt from a style manual."Every word in a sentence should provide necessary information. Remove all unnecessary words."Based on the information in the style manual, choose the BEST way to write the sentence below.History is a topic that is an interesting one due to the fact that new facts are frequently uncovered.History is a topic that is an interesting one because of the truth that new facts are frequently uncovered.History is a topic that is interesting due to the fact that new facts are frequently uncovered.History is an interesting topic due to the truth that new facts are frequently uncovered,History is an interesting topic because new facts are frequently uncovered. A public health expert is worried that a recent outbreak of a disease may be related to a batch of spinach from a certain farm. She wants to test the plants at the farm, but it will ruin the crop if she tests all of them.If the farm has 5,000 spinach plants, describe a method that would produce a random sample of 10 plants.Why would a random sample be useful in this situation? A new pair of jeans cost $124.97 in the sales tax rate is 9.3% you only have $140 to spend do you have enough money to purchase the jeans In need of help its due in an hour!! Ill give brainliest to the best answer Please and thx line cd in DE are tangent to circle a shown below ifCE is 130 what is the measure of angle CDE 2040 42.550 Statements True or False 4.086 Okay so i have a 69.71% in a class, i need a 70% to pass. I have one test left. What grade do i need to get on the test to gt at least a .29% increase. Please Answer. Its was estimated that 250 people would attend the movie, but 235 people actually attended. What is the percent error, to the nearest percent, of the estimate? Which compound in the following reaction serves as the Bronsted-Lowry acid?NaOH + HCl NaCl + H2OO NaOH, because it is a proton donorO HCI, because it is a proton donorO NaOH, because it is a proton acceptorHCI, because it is a proton acceptor if answers correct you get brainist! Solve x^2-26=0Answer: x=+-____ The little fuzz of bread mold on the edge of a slice look small in harmless so you scrape the spot off to make a sandwich anyway you think the site is safe to eat but it isnt that blue green blob is only the visible end of the network of tiny roots twisting depot near the surface whats more it is reproductive and popping up to release thousands and thousands of microscopic spores not only is that particular slash through a contaminated the rest of the love is as well luckily most bread molds are poisonous but sometimes cause nausea vomiting and headaches identify the topic of the paragraph and what the offer is saying about the topic from that Find the stated main idea (a)A Student charges two balloon and hangs them side by side. Explain why cotton threads are not vertical. Write the equation of the circle containing the point (8, 1) and a center at (4, 9). Will give brainly In two or more complete sentences explain how to balance the chemical equation,CH4 + O2 CO2 + H2O and include all steps. Read this passage from a 1946 speech by Winston ChurchillIt is my duty ... to place before you certain facts about thepresent position in Europe. From Stettin in the Baltic toTrieste in the Adriatic, an iron curtain has descendedacross the Continent. Behind that line lie all the capitals ofthe ancient states of Central and Eastern Europe. Warsaw,Berlin, Prague, Vienna, Budapest, Belgrade, Bucharest andSofia, all these famous cities and the populations aroundthem lie in what I must call the Soviet sphere, and all aresubject in one form or another, not only to Soviet influencebut to a very high and, in many cases, increasing measureof control from Moscow.2How did the ideas expressed in the passage influence the Cold War?A. They established a clear border between Europe's communist andnoncommunist regions.B. They were used to justify aggressive actions such as the BerlinblockadeO C. They encouraged the United States and Soviet Union to increaseaid to their alliesD. They encouraged small countries to remain nonaligned in ColdWar conflicts Oscar rides his skateboard 5858 mile in 1414 hour. How fast, in miles per hour, does he ride his skateboard? ANNOTATE THREE "IMPORTANT" PAGES OF CURIOUS, INCLUDING-VOICE (SYNTAX AND DICTION)-THE THEME OF TRUTH VS LIES Find the surface area of the composite figure.6 cm5 cm4 cm6 cm15 cm3 cm Can someone please tell me what 35% of 80 is.