Which kinds of evidence are included in the excerpt? Select 3 options.

a statistic
an example
a quote
a hypothetical situation
a fact
the author’s personal story

Answers

Answer 1

Answer:

The answers are B,D,E

Explanation:

I just took the test on edg and got it right

Answer 2

Answer:

The answers are B,D,E

Explanation:


Related Questions

Have you ever felt as if you were a part of your things, or that your things represented who you were? Think about your room? What sorts of decorations or furniture do you have? Did you choose it? If so, how does it represent you? If you didn’t choose it, do you feel as if you have given it a certain personality at all? How is it possible that these “things” can embody or represent a person? Write 1-2 paragraphs discussing how objects can represent your, or someone else.

Answers

Answer:

I have felt this way yes.

Explanation:

I think they represent yourself because it is what you like and apart of your personality. If I were to have "Indie" items in my room then people would think that is what I like. If I had plants and brown furniture that shows who I am as well.

How does the setting in the trailer compare with

the setting in the original source text?

The setting in the trailer is from an earlier time

period than the original source text.

0

The setting in the trailer changes, but the

source text only takes place in the kitchen.

The setting in the trailer remains the same,

but the source text changes locations.

The settings in the trailer and the source text

are identical.

DONE

) Intro

Answers

Answer:

You have not provided information about the text or the trailer to which your question refers, but anyway I will give you an explanation so that you can answer it for yourself.

Explanation:

 In literature, we refer to setting as the place and time where a story happens.

We can not only consider as setting the physical place where the story is happening, but also the time in which it does. Although there are several scenarios within a work, one of them will always be the main one.

Anyway, if you could give me the name of the work you are referring to, I will give you a specific answer.

Part 1:

B: The setting in the trailer changes, but the source text only takes place in the kitchen.

Part 2:

C: The film uses darker lighting to match the serious subject matter of the play.

15.2

__________________________ 28. True or False? Another name for organic matter is humus.
__________________________ 29. True or False? Organic matter is typically 15%–20% of the total volume of soil.

Answers

Answer:

28 true. Humus: the organic component of soil, formed by the decomposition of leaves and other plant material by soil microorganisms.

29 false,  Soil organic matter is the fraction of the soil that consists of plant or animal tissue in various stages of breakdown (decomposition). Most of our productive agricultural soils have between 3 and 6% organic matter. Soil organic matter contributes to soil productivity in many different ways.

what type of figurative launguage is “ wisdom gently whispers to us from evil”

Answers

Answer:

personification

Explanation:

fahrenheit 451 we learn why there are jets flying overhead. What is the reason?

Answers

Answer:

Bombers create a disturbance by flying overhead, which jar the citizens on the ground and build suspense. The presence of bombers and Montag's commentary regarding the continual war also satirize America's use of military force.

Explanation:

Read the excerpt from The Odyssey. My home is on the peaked sea-mark of Ithaca under Mount Neion's wind-blown robe of leaves, in sight of other islands—Dulichium, Same, wooded Zacynthus—Ithaca being most lofty in that coastal sea, and northwest, while the rest lie east and south. A rocky isle, but good for a boy's training; I shall not see on earth a place more dear, Read a student's paraphrase of the excerpt. Odysseus's home is Ithaca, a rocky island surrounded by other islands. Odysseus considers Ithaca a great place in which to grow up. What key detail should be added to strengthen the student's paraphrasing of this excerpt?

Answers

This question is missing the options. I've found them online. They are the following:

What key detail should be added to strengthen the student’s paraphrasing of this excerpt?  

A) Dulichium, Same, and Zacynthus are all visible to Ithaca.

B) Odysseus holds his home very close to his heart.

C) The islands surrounding Ithaca lie to the east and the south.

D) Ithaca lies under Mount Neion and to the northwest.

Answer:

The detail that should be added to strengthen the paraphrasing is:

B) Odysseus holds his home very close to his heart.

Explanation:

A paraphrase consists of rewording something that was said by someone else. That is, we say the exact same thing but with different words. Thus, to strengthen the student's paraphrase in this case, we must look for the idea that is missing.

In the original excerpt, Odysseus talks of Ithaca's geographic location, the fact that it is a good place "for a boy's training", and the fact that the island is a place he loves:

I shall not see on earth a place more dear.

However, the student's paraphrase has left out this last idea. To make it more complete, we should add that Odysseus holds his home very close to his heart.

Which is the best example of a complex character?

Answers

Answer: a man who is usually honest but occasionally lies

Explanation:

How could a reader make a text-to-text connection after reading A Lawn Mower in Sheep's Clothing?

remembering an encyclopedia article about swamps
remembering pictures of Paris from a book about France
remembering a story about a lion family in Africa
remembering pictures of bees from a book about insects
PLEASE HURRY

Answers

Answer:

a

Explanation:

A reader makes a text-to-text connection after reading 'A Lawn Mower' in Sheep's Clothing:

A.Remembering an encyclopedia article about swamps

A reader makes a text-to-text connection after reading 'A Lawn Mower' in Sheep's Clothing by remembering an encyclopedia article about swamps.

Thus, the correct answer is A.

Learn more :

https://brainly.com/question/20276892?referrer=searchResults

What is a 5 paragraph essay?

Answers

Answer:it’s e

Explanation:e

Answer:

The five-paragraph essay is a format of essay having five paragraphs: one introductory paragraph, three body paragraphs with support and development, and one concluding paragraph. Because of this structure, it is also known as a hamburger essay, one three one, or a three-tier essay.

Explanation:

Which sentences feature a first-person point of view? ​

Answers

Answer:

anything that has words like "I" or "me"... personal pronouns (we, us, etc)

Explanation:

you didn't give any options, so I can't give a specific answer

The use of me, my, I, etc. show first person pov. Here are some examples:
•I went to the mall to buy a gift.
•My best friend loved her gift!
•She told me that it was her favorite gift.
I hope this is what you’re looking for, good luck.

What inference about the Haida people’s life experiences can be drawn from the details in this story?

Answers

C.)People could not find drinkable water at the beach.

what are smart word for an language art essay​

Answers

Answer:

Some smart words to use for an essay are things that are interesting, and stand out more. Start writing your essay, and then after you complete that, then look up synonyms for words that you may want to replace, such as "because", or "in conclusion'.

Explanation:

when giving evidence say things like “for example, in the text...” or “for instance, in the text”. use a thesaurus to find synonyms for words that are basic or that have been used multiple times through out the essay

Who narrates "The Yellow Wallpaper"?
A. A middle-aged doctor from the city
B. A nurse named Jennie
C. Mary, a nun who cares for a young infant
O D. A young wife and mother

Answers

Answer:

I guess its D.

Explanation:

which dialogue would be found in a drama?

Answers

Answer:

A Protagonist.

Explanation:

The main character of the play is known as the protagonist. The antagonist is the character who opposes the protagonist. The other characters that are neither the protagonist nor the antagonist are called the secondary characters. They may have a major part or a minor involvement in the drama.

Answer:

Heather: If I wanted to clean all day, I would have stayed home.

Explanation:

For example it will give the actor name and the line

Foxy: What up

Freddy: Nothing

a.
C.
Which sentence has the correct capitalization?
The Patels have moved to the Southwest. Drive past the South entrance and turn left.
b. Jim's house is two miles North of Otterbein. d. "North by northwest" is a famous Hitchcock
movie.

Answers

Answer:

the patels have moved to the southwest has correct capitalization

Explanation:

can someone help me plz?

Answers

Answer:

no

Explanation:

Answer:

2, 3, 4, 1

Explanation:

Which sentence uses menace correctly?

Hearing the defendant’s crimes in the courtroom made us realize he was a menace to society.

I gave my medical history at the doctor’s office, which was a menace.

It is important to be a menace when introducing yourself to your friend’s parents.

Management is a menace to new employees, which makes them feel welcome.

Answers

Answer:

I belive its the first one

Explanation:

Menace means troublemaker basically

Answer:

The first one “Hearing the defendant’s crimes in the courtroom made su realize he was a menace to society”

Explanation:

Meance means that “a person or thing that is likely to cause harm; a threat or danger.” according to Oxford Languages. This means that the last two are wrong automatically. The second one could be an answer, but the first Sentance  makes overall better use of the word and is correct.

Everyone is capable of lying, killing, and betrayal; in other words, of being evil.

Do you disagree or agree?
Explain why

Answers

Yes, to protect themself or a love one

Answer:

I say Agree

Explanation:

my reasoning is that, while everyone is significantly different through both a physical, mental and emotional sense, that does not mean that that nicest person is not capable of being a criminal, lying or betraying. The crime, also, does not have to be skilled and well planned out in order for it to count because in the end it depends on the perosn as to whether or not they will choose to kill. Which essentially correlates back to the idea that anyone is capable of killing, lying, and betraying someone. it just a matter of whether or not the person chooses to carry out the action that makes it so controversial.

Which statement provides the best evidence that it is dangerous to text and drive at the same time?
According to a study, a person who texts while driving is 23 times more likely to get in a collision than an undistracted
driver is.
O According to a study, one-third of people prefer communicating through text messaging to making phone calls.
O According to a study, 96 percent of police reported car crashes in 2012 involved passenger vehicles.
According to a study, 40 percent of teenagers have been a passenger in a car with someone who is sending text
messages.

Answers

Answer:

According to a study, a person who texts while driving is 23 times more likely to get in a collision than an undistracted

driver is.

Explanation:

Answer:

A

Explanation:

e2020

The letter was written by my sister______________

A) isn’t it? B) wasn’t it?C) doesn’t it? D) was it?​

Answers

Answer:

B) wasn't it. is the answer

How important quantitative research across fields? Cite at least five fields and explain how quantitative research is interconnected with it

Answers

QUANTITATIVE RESEARCH ACROSS FIELDS A. Quantitative Research and Anthropology > Many discoveries in this field like human behavior in the society, racial conflicts and human evolution have given enormous contributions to the improvement of human life.

Quantitative Research can be applied in the fields of:

Statistics: This can be applied in the field of statistics to measure the flow of data and to calculate regression.Biology: This can be used to calculate the age extinct species were last seen and the age of fossils.Geography: They are used to know the age of the formation of a rockMathematics: They are used in the field of mathematics to study linear graphs and solve equations.Chemistry: They are used here to measure the valence of electrons,etc.

Quantitative research is the use of numerical data to process, analyze and make prediction about certain things.

Read more here:

https://brainly.com/question/18518499

why can't you put the limits to 24h

Answers

Answer:

I am not aware of a limit of any-sort in Brainly, if there is one I am not aware of though I would say it's because people who don't post more than every day probably don't really want answers.

Explanation:

Which sentence contains a correctly punctuated nonrestrictive modifier?

Jake, who is twenty-seven, is studying to be a yoga teacher.
Jake who is, twenty-seven, is studying to be a yoga teacher.
Jake who is twenty-seven is, studying to be, a yoga teacher.
Jake, who is twenty-seven is, studying to be a yoga teacher.

Answers

Answer: The correct answer is A

Explanation: Jake, who is twenty-seven, is studying to be a yoga teacher.

Ask a question about your assignment
Write a retelling of the story "The Medicine Bag" from Grandpa's point of view.
Based on the details provided in the story, imagine Grandpa's journey to see his
family. What are his impressions of Martin and his friends? How does he feel about
giving the medicine bag to Martin to preserve a sacred Lakota tradition?
I
A
U
M
English
ASK YOUR QUESTION

Answers

Answer:

hey sport the answer is A i just got this

Explanation:

The body paragraphs are meant to do what

Answers

I’m pretty sure they are meant to provide information in more detail about the topic or introduction paragraph, hope that jelped

In Enrique's Joumey, Sonia Nazario tells readers about Enrique's emotional journey as he tries to leave Honduras. Why does writing about this in the form of a biography support her purpose?

Answers

Answer:

She is able to provide her opinion about enriques difficult situation.

Explanation:

I did the test a while back and got the question right with this answer

Hope it helps!!!✌

Answer:

The answer is A.

Explanation:

please give brianliest

4-5 SENTENCE SUMMARY OF BEAUTY AND THE BEAST!

Answers

Answer:

A prince cursed to spend his days as a hideous monster sets out to regain his humanity by earning a young woman's love. Having lived a life in selfishness, young Prince Adam is cursed by a mysterious enchantress to having the appearance of a monstrous beast.

Explanation:

i love that show

Everyone learns the same way. Do you agree or disagree with this statement? Why or Why not?

Answers

Answer:

I disagree to a huge extend, no one's brain can biologically be the same. Other people may prefer using logic or reasoning to help them understand concepts. They aim to understand the reasons behind the learning, and have a good ability to understand the bigger picture. Some like to learn alongside others/in groups and may be confident asking questions out loud.

Explanation:

I completely disagree; no two people's brains can possibly be alike physiologically. Others might choose to apply logic or reasoning to make sense of notions.

Do people learn in the same way?

While current experts acknowledge that not everyone learns in the same manner, they also argue that our interests and preferences, rather than an innate learning style, have a greater impact on how we recall new information. For instance, there is a larger likelihood that someone who likes playing the piano and is eager in improving their talents in this area would learn more quickly than those who don't.

However, a student's background and skills also play a role in getting higher results. In any event, the discussion around learning styles has enabled the creators of e-learning courses to broaden their method of instruction and include more instructional strategies.

Learn more about learning, here:

https://brainly.com/question/1503472

#SPJ2

Emotional support needed...

Answers

Answer:

you can e m a i l me if u need

Explanation:

Ito po Yong meening ng factual claim and opinion at saka commonplace assertion?

1.factual claim is define as a statement which can proven from evidence such us as fact personal observation, reliable source, or expert opinion

2.An opinion is a statement of belief, feeling or though. It does not require a proof.


3.A commonplace assertion is a statement that many people assume to be true but which is not necessarily true.

Answers

Answer:

1.factual claim is define as a statement which can proven from evidence such us as fact personal observation, reliable source, or expert opinion  - True

2.An opinion is a statement of belief, feeling or though. It does not require a proof.  - True

3.A commonplace assertion is a statement that many people assume to be true but which is not necessarily true. - True.

Explanation:

The three concepts above are used to promote a good and efficient evaluation of an argument. Through the knowledge of these concepts it is possible to determine strong and weak arguments, in addition to evidencing whether the speech was well constructed, if it presents correct, relevant and true information, as well as assessing the ability of the speakers to recite it and be positive in relation to the interpretation of your words.

Other Questions
How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change? can you plzzzzzzzzzzzz help me What is 6/20 of a dollar BRAINLIEST IS RIGHT