what was the mission or goal of the whitecaps?

Answers

Answer 1

Answer:

To Bring Communities Together and Motivate Them

Explanation:


Related Questions

.In your own words, explain what the Enlightenment period was about?

Answers

Answer:

Explanation:

Enlightenment, a European intellectual movement of the 17th and 18th centuries that ... of reason, the power by which humans understand the universe and improve their own condition. ... Italy: The era of Enlightenment reform.

The term industrialized means?

A. Industries ina country on a large scale

B. The flow of people moving from one place to another

C. Believe in spirits of there ancestors ,air,earth, and river

D. Most important or powerful

Answers

The answer might be c

the answer is the first option, A.

take a very carefully look at the pictures below. write a brief paragraph of the photo using imagery, diction and figures of speech​

Answers

Answer:

this picture shows nursing who mitigate the case of corona virus

what is the Ancient Chinese Beliefs chart

Answers

Three major religions or philosophies shaped many of the ideas and history of Ancient China. They are called the three ways and include Taoism, Confucianism, Buddhism, and Legalism.
Taoism
Taoism was founded during the Zhou Dynasty in the 6th century by Lao-Tzu. Lao-Tzu wrote down his beliefs and philosophy in a book called the Tao Te Ching.
Taoism believes that people should be one with nature and that all living things have a universal force flowing through them. Taoists didn't believe in a lot of rules or government. In this way they were very different from the followers of Confucius.
The idea of Yin and Yang comes from Taoism. They believed that everything in nature has two balancing forces called Yin and Yang. These forces can be thought of as dark and light, cold and hot, male and female. These opposing forces are always equal and balanced.
Confucianism
Not long after Lao-Tzu founded Taoism, Confucius was born in 551 BC. Confucius was a philosopher and thinker. Confucius came up with ways that people should behave and live. He didn't write these down, but his followers did.
Confucius' teachings focus on treating others with respect, politeness, and fairness. He thought that honor and morality were important qualities. He also said that family was important and honoring one's relatives was required. Unlike Taoists, followers of Confucius believed in a strong organized government.

Buddhism
Buddhism was based on the teachings of Buddha. Buddha was born in Nepal, just south of China, in 563 BC. Buddhism spread throughout much of India and China. Buddhists believe in a "rebirth" of the self. They also believe that the cycle of rebirth is complete once a person lives a proper life. At this point the person's soul would enter nirvana.
Legalism
Idea of Legalism: Punishment for bad behavior and a reward for good behavior. Legalists believe the people of
China should work to serve the government and the emperor Shi Huangdi demands ALL BOOKS BE BURNED except books on Medicine, Technology, and Farming. Hope this helps! Mark brainly please!

The negative impact of President Reagan’s involvement in the Iran-Contra Affair was offset by the
invasion of Grenada.
signing of the INF Treaty.
release of hostages in Iran.
ousting of the Sandinistas.

Answers

Answer: B

Explanation: edg 2021

The negative impact of President Reagan’s involvement in the Iran-Contra Affair was offset by the signing of the Intermediate-Range Nuclear Forces Treaty (INF).

What do you know about the Iran-Contra affair?

The Iran-Contra affair took place during President Ronald Reagan's second term in office. The issue arose because President Reagan did not maintain the momentum created by his colleagues, and that momentum collapsed. This made him look bad as President.

However, when he signed the Intermediate-Range Nuclear Forces Treaty(INF), a treaty that established forces in the United States and the Soviet Union, people began to respect him more.

Therefore, the signing of INF Treaty offset President Reagan's involvement in the Iran-Contra affair.

learn more about  Iran-Contra affair here:

https://brainly.com/question/2088335

#SPJ2

19. Which of the following reasons led to the Civil War? *
—taxes
—slavery
— oil rights
— religious freedom

Answers

I think the answer is Slavery. The oil stuff hasn’t come into play yet and there wasn’t big stuff on taxes which leaves you with Slavery and Religious freedom. Which one makes the most sense is Slavery. Because the north was ridding of it but the south wanted to keep it

In what ways was Jackson telling the truth

Answers

who is jackson?!?!?!?
We don’t know who Jackson is??

72. Which of the following is a U.S. territory?*
Cuba
Guam
Hawaii
Panama

Answers

Answer:

Guam

Explanation:

Guam is the only United States territory in this question.

Cuba is their own republic.

Hawaii is a US State, not a territory.

Panama is a Central American country.

In 1965 a riot broke out in the Watts neighborhood in the city of
.

The riot occurred as a result of
.

The violence lasted for
as rioters demanded equality.

By the time it ended, 34 people had died and
had been arrested

Answers

Answer: Los Angeles,  

An arrest,

Several days,

thousands

Explanation:

Answer:

In 1965 a riot broke out in the Watts neighborhood in the city of ✔ Los Angeles

The riot occurred as a result of  ✔ an arrest

The violence lasted for ✔ several days as rioters demanded equality.

By the time it ended, 34 people had died and ✔ thousands more had been arrested.

Explanation:

What action would be expected of an ideal Southern woman of the middle or
upper class?
A. Making her home comfortable
B. Providing for her family
C. Protecting her family
D. Giving her views on politics

Answers

Answer:

A

Explanation:

Making her home comfortable

43. The Bill of Rights protected
A. State rights from the power of the federal government
B. Individual citizens from the power of the federal and state governments
C. Minority groups from the power of the majority
D. Gave the Senate the right to approve or reject treaties negotiated by the president

Answers

Answer:

B. Individual citizens from the power of the federal and state governments

Explanation:

The first 10 amendments to the Constitution, known as the Bill of Rights, guarantee essential rights and civil liberties, such as the right to free speech, the right to bear arms, and the right to a fair trial, as well as protecting the role of the states in American government.

What challenges did Native Americans face during World War II?

Answers

Answer:

A lot of the Navajo denomination specifically went off to war as code talkers who spoke their native language as a code and were often subjected to harsh treatment despite this fact. Also, the common population of the US didn't know their role in the war and resented them for "Trying to be White" when they wore their uniform.

Read Code talker

by Joseph Bruchac

It's great and super intriguing, I think it turned into a movie too :)

arrange 1/2,2/3,1/4,3/5 in ascending order

Answers

Answer:Now, multiply both numerator and denominator by 3 = 5 × 3/6 × 3 = 15/18 Arrange the following fractions 1/2, 3/8, 2/3, 4/5 in ascending order.

We know that 1/4 of 4 means 1/4 × 4, let us use the rule of repeated addition to find 1/4× 4.

Explanation:

What did southerners believe about slavery

Answers

Slavery was given to them, they bought their rights and they felt like that was justification for buying blacks.
There was this superior ideology amongst white Southern plantation owners, and many found slavery to be an effective economic system.

The actions outlined in the last paragraph best illustrate which of the following weaknesses of the anti-globalization movement?
A
The anti-globalization movement encompassed too many different groups around the world and advocated too many different goals to be truly effective.
B
The anti-globalization movement focused on social problems arising from cultural or racial bias, but neglected problems arising from economic inequality
с
The anti-globalization movement did not make effective use of new communication technologies to broaden its appeal.
D
The anti-globalization movement advocated revolutionary methods of political change.

Answers

Answer:

The anti-globalization movement encompassed too many different groups around the world and advocated too many different goals to be truly effective.

Explanation:

A sentence that has judicial review

Answers

These have worked satisfactorily and have been upheld in judicial review hearings. If its conduct is unreasonable, it will be open to judicial review. The law provides a remedy for that by way of judicial review. It should not lead to litigation and it will withstand judicial review. Hope this helps! Mark brainly please!

in the early 1800 american indians were not allowed to live in the great plains because

Answers

Answer:

Conditions on the Great Plains were harsh. Temperatures were extreme with freezing cold winters and incredibly hot summers. Lighting flashes could cause the grass to set alight, causing huge grassfires that spread across the Plains. The land was dry and unproductive making it difficult to grow crops.

Explanation:

The person that wrote first is right

Explain why a system of alliances could cause multiple countries to join a war that starts between only 2 countries.

Answers

The alliances system meant that a local conflict could easily result into an intimidating global one

What fatal flaw did General McClellan have that made him a bad general?

Answers

Answer:

hi

Explanation:

he made him his asistant for life

If a candidate wins a majority of the votes in a state, besides Maine and Nebraska, how many Electoral votes does the candidate receive from that state?

1.The same percentage they won by
2.All the Electoral votes
3.Half the Electoral votes
4.None of the above

Answers

Half the electoral votes

How does Antony's speech change the viewpoint of the
citizens?
O
Their love for Caesar is gone, and they are
convinced that Antony should be the next emperor.
They understand that Brutus was telling the truth
about Caesar's ambition.
O
Antony reminds them that Brutus is a good person,
and only wants what is best for Rome.
They realize that Caesar should not have been
murdered and Brutus misled them.

Answers

Answer: They realize that Caesar should not have been murdered and Brutus misled them.

Explanation: I took the test and reviewed it :D

Answer:

the person above is correct

Explanation:

how was Africa culture and language affected by contact with other cultures through trade of goods and slaves

Answers

Answer:

The trans-Saharan trade network that was established between west Africa, Arabia, and Europe had dramatic cultural implications for people along the way. The most profound impact was the introduction of Islam to the peoples of Africa, both in the north and west. Islam was also introduced to a lesser extent in Europe, primarily Spain. Islam also helped to increase literacy in places that it was introduced due to the importance of reading the Koran.

Muslim scholars and merchants also spread ideas to all parts of Africa during this period. Universities were established in parts of west Africa and the Maghreb. Learning and ideas were shared to an extent that was previously not witnessed.

The economies of Europe and the Arab world were changed with the introduction of gold and other precious metals that were mined in west Africa. This was a period where many of those economies had moved to a monetary system and gold was necessary to sustain these economies and currencies. Commodities were available for sale throughout the regions that were not previously available, which strengthened the way of life of all of the cultures involved.

When different cultures come in contact with one another, a process that is called cultural diffusion takes place. The process changes both cultures through the exchange of ideas. With the number of different cultural groups that participated in trans-Saharan trade, the variety of ideas shared would have impacted all the peoples involved. For this reason, virtually all elements of culture would have been impacted at every city along the route.

Explanation:

Please do the whole assignment will give 200 extra points!! Also you get brainliest.

Answers

It’s a blank image it doesn’t work

What was the role of women in the black panther party

Answers

Answer:

The BPP’s Ten Point Program outlined a vision for liberation, encompassing demands for jobs, housing, education, and self-determination. In its early phase, the party’s activity focused on “point 7”: the fight against police brutality. Making use of their Constitutional rights, the Panthers boldly asserted their intention to use arms to defend the Black community from police violence. the struggle against anti-Black racism was the central flashpoint that opened up a mass radicalization around a whole host of issues––from war and imperialism, to women’s and LGBT oppression, to class inequality and capitalism. By the end of the 1960s, millions of young Americans believed a revolution was necessary in this country and thousands flooded into revolutionary groups like the BPP.

Explanation:

0n February 1970, Kathleen Cleaver, communication secretary of the Black Panther Party (BPP), was asked by a reporter and She responded, in part: “No one ever asks what a man’s place in the Revolution is."

what limitations does the Torah have as a historical source ?

Answers

Answer:

The limits is that the Torah has high chances of having many stories over-exaggerated or a bit tweaked which does not make it a good historical source. To be considered as a strong and reliable historical sources, it needs what historian called as a primary sources.

What is the major difference between an argumentative thesis and an explanatory thesis?

Answers

Answer:

an argumentive thiesis argues some thing wheras an explanitory theisis explains something.

What message did Nixon send by choosing Henry Kissinger as
his key advisor on national security and international affairs?

Answers

Answer:

By choosing Kissinger as a National Security Advisor, Nixon send a message that regardless of political contradictions, choosing a right person is vital for a nations growth.

Explanation:

Richard Nixon served as the 37th President of the United States from 1969-1974. After he was elected the President of the United States, he chose Henry Kissinger to be his National Security Advisor.

Henry Kissinger previously made remarks on Nixon's presidency and considered him unworthy to hold the position. Despite such remarks from Kissinger, Nixon chose him as his National Security Advisor. By doing so, Nixon sent a strong message that despite having political contradictions, choosing the right person is important. By choosing Kissinger, Nixon made the right decision for his country's growth.

The message that Nixon sent a message by appointing Kissinger as National Security Advisor: regardless of political differences, selecting the proper person is critical for a country's success.

Why did Nixon choose Kissinger as his key advisor?

Nixon and Kissinger were both devoted to realism that concentrated on American economic advantages while eschewing moralism in policy about foreign.

As Nixon's National Security Adviser, Kissinger pioneered the detente approach with the Soviet Union, aiming to reduce tensions between the two superpowers.

Thus, the reason Nixon gave is selecting the proper person is important for the country.

Learn more about Nixon and Kissinger here:

https://brainly.com/question/540353

3. According to Madison: (Select all that apply)
a) Ultimately, we must have faith that government will be run by enlightened statesmen who put themselves above politics and seek the public good.
b) Where there is no impartial judge to settle disputes the most powerful faction is likely to prevail
c) Settling disputes must be done by the people themselves, not by government authority
d) Many important acts of legislation, including taxation, require an impartial judge.

4. Why does Madison reject a pure democracy (a system where a small number of citizens assemble and administer the government in person)? (Select all that apply)
a) It can control factions if they are a minority but not if they form the majority
b) It doesn’t protect the weaker party in disputes
c) It cannot cure the mischiefs of faction
d) It is always incompatible with the rights of property and personal security

5. According to Madison, the true interests of the country are best determined by:
a) The election of a chosen body of citizens
b) The people themsleves
c) George Washington
d) By those committed to the protection of their property

Answers

Answer:

Read below

Explanation:

3: A ( Madison supported the good of the public )

4: C and maybe B (C because you can compare our world today that theres still some stuff needed to be fixed and maybe b because stuff like the Green's or whatever political parties that are small don't get there voice heard )

5: B ( since the country was meant to be decided by the people )

Why was it important that the 1936 Olympics were televised?

Answers

Answer:

Explanation:It was the first Olympic competition to use telex transmissions of results, and zeppelins were used to quickly transport newsreel footage to other European cities. The Games were televised for the first time, transmitted by closed-circuit to specially equipped theatres in Berlin.

someone please quick 100PT if completed :Write a journal from the perspective of a child working in a factory. Your journal must have at least five entries (minimum of 60 words each (300 total)) that detail the living and working conditions children faced during the industrial revolution.

Answers

Answer:

Entry One

March 14th, 1884

William Porter

Age: 8

Job: Tailor

Dear Diary:

I guess today is another thrilling day, and this morning I wake up at 4 o’clock in the morning to get ready to work by 5 am. My brother Thorn and I walked there and we were a bit late today. And I didn’t even have any breakfast. Once we got there, we started to work immediately. Then someone stared at me. It was the man in the uniform. He yelled at me just because I whispered to the other person sitting next to me then I saw some kids playing in the street and I felt very disappointed and jealous. Why I can’t go out side and play in the street like these kids but I guess that’s part of life. We usually get two breaks during the day, Lunch and dinner. But today I didn’t get any break. And I have to work straight though it. I’m starving and my hands are very sore. I usually have to work 14 hours a day but since Thomas Edison invented the light bulb I only have to work for 10 hours. And finally my work is done and it’s 5pm. My wage is 20 cents a day but most of the boys who are younger than me get 25cent per day or even 30cents per day. I don’t know why but my parents say that I have to work or we have to live on the streets.

Answer:

Explanation:wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww

Other Questions
A steel bottle contains nitrogen gas at STP. What is the final pressure if the temperature is changed to 155C? Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls?