What prevents a lake or ocean from freezing solid?

What Prevents A Lake Or Ocean From Freezing Solid?

Answers

Answer 1

Answer:

The surface layer of the water freezes solid creating a barrier that insulates the ice below so that it keeps a steady temperature usually a few degrees above freezing (32 degrees).

Explanation:


Related Questions

Organisms such as yeast can reproduce through mitotic division. During this type of reproduction, nondisjunction is possible.
True
False

Answers

I believe that it is true
i think it is true because true

What makes an isotope radioactive? Are all isotopes radioactive?

Answers

Answer:

Radioactive Elements

In elements with more than 83 protons, all of the isotopes are radioactive. ... The force of repulsion among all those protons makes the nuclei unstable. Elements with more than 92 protons have such unstable nuclei that they don't even exist in nature.

Explanation:

hope it helps you

follow me for more

I'm willing to help

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Viruses differ from bacteria cells in that all viruses -

A)Causes insect-borne disease

B)Have rigid cell walls

C)Can be destroyed by antibiotics

D)Must be reproduced in living cells

Answers

Answer:

D) Must be reproduced in living cells

A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll

Answers

Answer:

GL Gl gL gl

Explanation:

A type of circuit that has only one path is called a —

Group of answer choices

series circuit

parallel circuit

open circuit

closed circuit

Answers

The answer is series circuit.

What is the function of cilia in the respiratory system? A. Move gases into the blood. B. Move food into the stomach. C. Move mucus into the throat. D. Move air into the lungs

Answers

the correct answer is c

Answer:

C or B sorry if I didn't help you

Explanation:

have a great day buddy

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.

Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.

Answers

Answer:

I'm in school I'll help you when get home around 4:30

The 1st organism in a food chain must always be what type of organism?

Answers

Answer:

Producer

Explanation:

I think it should be producer.

Answer:

Producer

Explanation:

The 1st organism in a food chain must always be what type of organism?

Producer

You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.

Answers

Answer:

C is the best answer

Explanation:

the dominate trait is in 3 of the four boxes

There is a 75% chance that each offspring will be tall. Therefore option C is correct.

When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.

The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.

The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.

Therefore option C  There is a 75% chance that each offspring will be tall is correct.

Know more about genotype:

https://brainly.com/question/31515990

#SPJ5

The owl is a nocturnal hunter of small mammals, insects, and other birds. An owl is an example of
A. Producer
B omnivore
C carnivore
D decomposer

Answers

Answer:

C carnivore:)

Explanation:

GIVING BRAINLIEST AND EXTRA POINTS!!


The octopus can change its coloring to blend into its environment, and the sweet pinesap plant appears to look like dead leaves on the ground. How do these adaptations help the plant and animal survive?

A) They protect them from predators.
B) They protect them from the environment.
C) They allow them to stand out.
D) They allow them to reproduce.

Answers

I think the answer is A, they protect them from predators
it’s a it protects them from predators

The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8. Which statement predicts how the stream's ecosystem will most likely be impacted? A The flow rate of the stream will increase B. The flow rate of the stream will decrease. с The number of fish in the stream will increase. D The number of fish in the stream will decrease.​

Answers

D....................

The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease.​ Thus, option D is correct.

What is the procedure to indicate the pH of the water stream?

The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8.The flow rate of the stream will decrease. The number of fish in the stream will increase and the number of fish in the stream will decrease.​

Acid rain is a form of rain with high concentration of hydrogen ions and is acidic in nature. pH of these rains is low and pH is the negative logarithmic of hydrogen ion concentration. It is known as power of hydrogen.

The animal which has the lowest value of pH will be able to tolerate the acid rain more and will be last to die. From the tolerance range of the animals, frogs has the lowest pH for survival which is 4 and it can bear more acid rain than the rest of the animals will be the last to die.

Therefore, The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease.​ Thus, option D is correct.

Learn more about acid rain on:

https://brainly.com/question/11543614

#SPJ2

explain how the genus and species name of an organism is properly written

Answers

Answer: The binomial system of nomenclature is structured so that the scientific name of a plant consists of two names: (1) the genus or generic name, and (2) the specific epithet or species name. ... The genus name is always underlined or italicized. The first letter of the genus name is always capitalized.

Explanation:

What are the five main phases of the cell cycle? What are the main events in each?

Answers

Answer:

In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.

Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.

Explanation:

good luck

please mark me as a brainliest

The products in our society that contribute the most waste are those that are _____.

Answers

Answer:

disposable

Explanation:

Biodegradable products do not really present any problems because they can decompose on their own, thus they do not create any pollution. Aluminum is not as dangerous to the environment as plastics, for example.

Plz I will give brainliest

Answers

The correct answer is C

What type of bond holds nitrogen bases together? And, how many of these hold Guanine and Cytocine together?

Answers

hydrogen bonds help hold the 2 chains of the DNA double helix together

Acid rain is caused by: *
*
O
a. Mass amount of CO2 in the atmosphere
O b. Reduction of pollutants
O c. Organisms that release acid into the atmosphere
O d. Planting more trees

Answers

Answer:

Mass amount of CO2 in the atmosphere

Why does Mr. Brunner care for Percy so much?

Answers

because he is watching over percy, and mr.brunner is actually chiron, a cenataur, and was taking percy to camp half blood

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

Outline the process of the Carbon Cycle.

Answers

Answer:

Carbon Cycle Definition

Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.

Carbon Cycle Steps

Following are the major steps involved in the process of the carbon cycle:

Carbon present in the atmosphere is absorbed by plants for photosynthesis.

These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.

These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.

Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.

These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.

Hope it helps!!!

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

why do some scientists believe that humans evolved from apes?

a: because fossil records show homologous structures indicating a common ancestor

b: because humans and apes lived around the same time period

Answers

Answer:

A

Explanation:

Because it is way more logic

Lysogenic viruses do not

Answers

Answer:

Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.

Explanation:

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

I need help on this one!​

Answers

Answer:

Classify I beilieve!

Explanation: You would need to do this because in order for you to study it you would have to classify them.

15 points answer please

Answers

Answer:

B

Explanation:

Answer: B
The particles will stop completely

Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!

What do agriculture and urbanization have in common?

Answers

Answer:

Agriculture and urbanization both have the goal of expanding human value of living.

Explanation:

Answer:

Explanation:

Basically both of them benefit each other .

Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands.  It can also bring major challenges for urban and rural food security.

Hope this helped !

Other Questions
Help brainiest answer:( What was the Married Women's Property Act and what was its significance? Choose the expression that represents a quadratic expression.A.) 6x4 5x3 + 3x2 7x 8B.) 5x3 + 3x2 7x 8C.) 2x2 + 3x 1D.) 3x 1 What are the solutions to the equation 3^2 + 6 31 = 7? & Explain how you determined your answer Choose the word that best replaces the underlined word in the sentence.What elements of our society have contributed to this insane trend?a.factorsc.degreesb.building blocksd.thingsPlease select the best answer from the choices providedABCD Solve: 4x = 32x = 4x = 8x = 4x = 8 find the Missing angle Who are Nagg and Nell?A. Just random old peopleB. Hamm's brother and sisterC. Hamm's parentsD. Clov's parents The triangular prism shown below is 6 \,\text{cm}6cm6, start text, c, m, end text wide and 4\,\text{cm}4cm4, start text, c, m, end text deep. The vertical height is 7\,\text{cm}7cm7, start text, c, m, end text. What is the length of the side edge, sss, of the triangular prism? "The Weimer Corporation wants to accumulate a sum of money to repay certain debts due on December 31, 2030. Weimer will make annual deposits of $150,000 into a special bank account at the end of each of 10 years beginning December 31, 2021. Assuming that the bank account pays 6% interest compounded annually, what will be the fund balance after the last payment is made on December 31, 2030?" Now that you have mapped some of the morphological characters on the evolutionary relationships, you should notice conflicts with regard to these characters defining some clades. What other types of evidence do you think scientists used to support this particular phylogeny, assuming the above phylogeny is correct A Chinese leader named Sun Yat-Sen who helped China to overthrow the last dynasty: True or false The mood of Puritan Salem in the Crucible is______A. Whimsical and lighthearted B. Serious and fearful C. Romantic and dramatic D. Bawdy and playful 7. If you want to narrow your search engine results by date, language, or region, what option should you look for in theSettings menu?A. Advanced SearchB. Boolean OperatorsO C. Safe Search ModeO D. Chronological Order Find the 51th term of the arithmetic sequence 29 9 -11 What was one of the main effects of the black death in Europe A: Workers could demand more pay for their labor B: European kingdoms fought more wars than before C: More people began trading goods with other manors D: People began to have more faith in their churches I really need this so 75 points. 1 A local college rents calculators to studentstaking math classes. The cost to rent thecalculator is $5 per month plus anonrefundable fee of $10. Write an equationto represent the cost, c, of renting acalculator for m months.2Fleanor hart I need with this and please show workkk If angle A measures 40 what is the measure of angle B? PLEASE HELP I AM TIMEDDDDD I WILL GIVE BRAINLIEST IF CORRECT- DONT DO FAKE ANSWERSWhat is the total surface area of the square pyramid below?132 m2144 m2160 m2228 m2