What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Answers

Answer 1

GTTCAAGCTACTGTTCAAGCTACT


Related Questions

NEED HELP ASAP! 100 POINTS!!
A lab experiment is created to see how the amount of solute affects the temperature needed to dissolve the solute completely. 2, 4, 6, and 8 grams of a salt are place in a small test tube with 15mL of water. The test tubes are then heated until the salt completely dissolves. Unfortunately, the test tube with 8 grams of salt never completely dissolves at any temperature. Suggest two changes to the procedure that might solve this problem.

Answers

Answer:

Rise the heat and lower the amount of salt

Explanation:

Please I need a comparison table between plant cells and plant tissues​

Answers

Answer:

Plant tissues are collections of similar cells performing related functions. Different plant tissues will have their own specialized roles and can be combined with other tissues to form organs such as flowers, fruit, stem, and leaves. Two major types of plant tissue include meristematic and permanent tissue.

Meristematic tissue, the primary growth tissue in plants, is capable of self-renewal and indefinite cell division. Every cell in the plant originates from a meristem. Meristematic tissue is classified into one of three types depending on its location inside the plant - apical, lateral, and intercalary. Apical meristems are meristematic tissue located at the tip of root and stem, which enable elongation of plant length. Lateral meristems are present in the radial portion of the stem and root and increase the thickness or girth of the maturing plant. Intercalary meristems occur only in monocots at the base of the internode and leaf blade. The intercalary meristems increase the length of the leaf blade.

Explanation:

I CAN TELL UPTO THIS MUCH.

I HOPE THIS ANSWERS HELPS.

THANK U!

How is the moon involved in the
hydrologic cycle?
B. it helps water evaporate
A. it provides light
C. it cools the Earth
D. it causes tides

Answers

Answer:

Explanation:

it cools the Earth

The moon does affect evaporation. The heat from the sun which is reflected off of the moon helps to evaporate and sublime water at night. It also helps evaporation during the day. During eclipses however, the moon really slows down the process of evaporation by covering up the sun.

So it’s ( it helps water evaporate) hope this helps if not let me know so I can try again:)

What conclusion is best supported by the selection above ? NUMBER 2

Answers

Answer:

Arginine and Lysine play same role in membrane proteins.

Explanation:

The scientist have tested Lysine and Arginine to get information about their properties. The test lead to conclusion that both are amino acids which are high in aqueous values which lead to high electrostatic interaction. These amino acids play important role in membrane proteins.

Many chemical reactions take place in living things. All chemical reactions have a certain amount of energy that must be supplied in order to make the reaction begin. This is called

Answers

Answer:

Activation energy...!

Explanation:

what is the last thing that happens when a cell divides to produce two new identical cells

Answers

Answer:

The last phase of cell division is cytokinesis. In this phase the cytoplasm of parent cell divides in to two cells called as daughter cells. It occurs during late stages of nuclear division.

The visible change of cytokinesis in an animal cell can be observed as formation of Furrow or Pucker on the cell surface.

Which mechanism best describes the process by which nutrients are taken up at the apical surface of the epithelial cells that line the guy and released from their basal and lateral surfaces?

a. Proteins are tethered to the cell cortex
b. Proteins are tethered to the extracellular matrix
c. Protista are tethered to the proteins on the surface of another cell
d. Protein movement is limited by the presence of a diffusion barrier

Answers

Answer:

The correct answer is option d. "Protein movement is limited by the presence of a diffusion barrier".

Explanation:

There are transportation mechanisms that allow to take up nutrients to the apical surface of the epithelial cells. The transportation process is best describes as protein movement limited by the presence of a diffusion barrier. There are structures known as tight junctions, located just below the apical surface . These tight junctions acts as diffusion barriers, separating the  extracellular fluids surrounding the apical and basolateral membranes.

Which compound is a hydrocarbon?
A. C2H6
B.CO2
C. C6H12O6
D. H2O

Answers

A. C2H6 I am positive it’s a

Please help fast!!

CELLS: How is the cell membrane different from a cell wall in its structure and
function?

Answers

Cell membrane helps to enclose the cell organelles and cytosol inside a cell. ... A cell wall is a ridgid, protective layer and it covers the cell membrane. For plants, cell walls are mainly made up of cellulose, while a cell wall in bacteria is made up of peptidoglycan,and for fungi it is made up of chitin.

simply means lessen the use of unnecessary materials

Answers

Answer:

ok

Explanation:

okokokokokokokkokokok0k0k

Reduce: simply means lessen the use of unnecessary materials.

Waste management can be defined as the processes, schemes, activities and actions that are typically required to collect, treat and manage (handle) a waste material from its creation to its final disposal.

Basically, some importance of waste management are:

I. It makes planet Earth free from garbage or waste materials.

II. It promotes a clean, beautiful and healthful environment.

III. It helps to transform garbage or waste materials into something useful through recycling.

The 5Rs of waste management generally refers to an efficient, effective and modern way of managing garbage and waste material, these include:

Refuse.Reduce.Reuse.Repurpose.Recycle.

Reduce is a waste management technique which involves lessening the use of unnecessary materials in the performance of a task.

For example, biodegradable materials can be burned to lessen waste.

Read more: https://brainly.com/question/18769370

Match each type of financial institution with its correct description.

Answers

Answer:

1. building society

2. trust company

3. asset management firm

4. stock brokerage firm

Explanation:

The Convention on Biological Diversity has goals that ________.

a. that ensure the distribution of biodiversity's benefits to wealthy countries who can pay for them
b. that require biodiversity be used in a sustainable manner
c. designed to reduce biodiversity
d. that include a set of international laws
e. spelling out future management plans for all biomes

Answers

Answer:

b. that require biodiversity be used in a sustainable manner

Explanation:

The Convention on Biological Diversity is a multilateral treaty that focuses on the use of biodiversity in a sustainable manner. The Convention on Biological Diversity is ratified by 196 nations.

There are majorly three goals of The Convention that include conservation of biodiversity; sustainable use of biodiversity; and equal sharing of genetic resources benefits.

Hence, the correct answer is "b. that require biodiversity be used in a sustainable manner".

it helps to promoting growth of roots and absorption of nutrients.

Answers

Answer:oil is a major source of nutrients needed by plants for growth. The three main nutrients are nitrogen (N), phosphorus (P) and potassium (K). Together they make up the trio known as NPK. Other important nutrients are calcium, magnesium and sulfur.

what would happen to the smooth er if the rough er was broken

Answers

Answer: The cell would no longer be able to produce ribosomes which are needed to make proteins.

Which of these is describing a Eutrophic Lake?

Mucky Water
Cold Water
Low Biodiversity
Rocky Bottomed

Plz answer I need help thank you

Answers

Answer:

Mucky water and rocky bottom

Answer:

mucy water ..........

What is the maximum magnification of most classroom compound light microscopes?
O 100x
O 500x
O 1,000x
O 5,000x

Answers

Answer:

C. 1,000x

Explanation:

Answer: 1000x c

Explanation:

The football team has a total of 25 jerseys . There are 5 mediums-sized jerseys . What percent of the Jerseys are médium-sized Jersey?

Answers

Answer:

20% or 0.2

Explanation:

if u divide 5 by 25, u get 0.2, which in decimal form is 20%

I've had my cat for three years. In that time she's gained half a pound. Explain the origin of her increased mass and whether atoms are still the same atoms as when she consumed them. ​

Answers

She has been eating creating additional atoms creating more mass and mass is the same as wen it was consumed

When organisms break the bonds of organic compounds the organisms can

Answers

Answer:

When organisms break the bonds of organic compounds the organisms can gain energy in the form of ATP.

Explanation:

Really Need This >:3


A

B

C

Answers

Answer:

I'm pretty sure it's A

Explanation:

To compress means to push together. I hope this helps

I think it is B yea it should be B

Cells that become the _________ undergo a ____________ to __________ transition first. Fill in the blanks.

Answers

Cells that become the Sclerotome undergo a epithelial to mesenchymal transition first.

The buring of fossil fuels releases which of the following gases into the atmosphere

Answers

what are the choices?

The knee ________.
a. is completely enclosed by a strong articular capsule
b. is a multiaxial joint
c. has ligaments present inside as well as surrounding the articular capsule
d. is the simplest joint in the body

Answers

Answer:

The correct answer is: C) has ligaments present inside as well as surrounding the articular capsule.

Explanation:

The knee joint is a hinge (ginglymus) type synovial joint that is formed by three different bones: the femur, the tibia, and the patella.

Given the nature of the hinge joint, it should only allow flexion and extension, but it also grants a small degree of internal and external rotation. For this reason, the knee joint cannot be considered a multiaxial joint, since it only fully moves in one axis and slightly moves in a second one (this is why most people consider the knee joint a uniaxial joint, but some others say it is actually a biaxial one).

The knee joint isn't completely enclosed by a strong articular capsule. The knee joint is rather thin and it contains the patella, menisci, bursae, and ligaments of the knee.

The knee is not the simplest joint in the body. It is formed by three bones and there's also the menisci, which are fibrocartilaginous structures that help increase the stability of the joint and act as shock absorbers as well.

The knee does have ligaments both inside and outside the articular capsule. The intracapsular ligaments are two cruciate ligaments (one anterior and one posterior), which hold the tibia in place; the transverse ligament that connects both menisci; and the posterior and anterior meniscofemoral ligaments. The extracapsular ligaments are the patellar ligaments (connects the patella to the tibia), the two collateral ligaments (medial and fibular, one on each side of the knee, connecting the femur to the tibia and to the fibula, respectively), and the anterolateral ligament.

Which type of rock is non-foliated metamorphic rock?

Answers

Answer:

slate, phyllite,schist and gneiss

Answer:

Letter A: Gneiss

Explanation:

we the people of the United states in order to form a more perfect union..."what was the purpose of the introduction that begins with these words?

Answers

Answer:

The preamble sets the stage for the Constitution, It clearly communicates the intentions of the framers and the purpose of the document. The preamble is an introduction to the highest law of the land; it is not the law. It does not define government powers or individual rights.

Establish Justice is the first of five objectives outlined in the 52-word paragraph that the Framers drafted in six weeks during the hot Philadelphia summer of 1787. They found a way to agree on the following basic principles:

"We the People of the United States, in Order to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defense, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution for the United States of America."

I think.

Explanation:

Please help!!!!!

Can you please help with the first box in the picture.

Answers

Answer:

mRNA: UUU/CUU/GUU/AAG/UUU/AAA/GGU/UGA

Amino Acids: Phe/Leu/Val/Lys/Phe/Lys/Gly/STOP

Explanation:

A-U

G-C

T-A

Sodium is an example of an alkali metal. The alkali metals are found in the leftmost column of the periodic table, known as Group 1. Use the interactive periodic table to explore the properties of the following alkali metals: lithium (Li), sodium (Na), potassium (K), rubidium (Rb), and cesium (Cs). The animations demonstrate a chemical property common to alkali metals: they react with water. How does the reactivity vary among this group of elements? Why might patterns like this be useful to scientists?

Answers

Answer:

The reactivity greatens the farther you go down on the periodic table. Lithium will have the weakest reaction, and cesium will have the greatest reaction. Patterns like this are useful to scientists because it shows which elements are the most reactive and which aren't. The farther down and to the left you go within the periodic table, the more reactive the elements become. The farther up and to the right you go, the less reactive they become.

Explanation:

The reactivity of alkali metals increases down the group. Periodic trends help scientists to predict the reactivity of newly discovered elements.

In group 1, reactivity of elements increases down the group because as you go down the group more shells are added thereby making it easier to remove the outermost electron.

This explains the increase in chemical reactivity from Lithium to cesium.

These periodic trends are very important in predicting the chemical reactivity of newly discovered elements that are added to a group.

Learn more: https://brainly.com/question/18153051

We could tell by the rotten smell, that something putrid was in our trash can
Explain the word putrid

A ample
B alive
C Rotten
D appealing

Answers

Answer

The answer is c

Explanation:

The correct answer is C rotten

Which two factors are responsible for seasons on Earth?
A. Greenhouse gases and ozone in the atmosphere
B. Earth's tilted axis and its rotation around it
C. Trade winds and sea breezes
D. Earth's tilted axis and its revolution around the sun

Answers

Answer:

D

Explanation:

The short explanation is how the earth is tilted towards the sun, and it's revolution will cause certain parts to be closer or farther relatively to the sun. Hope this helps

The change in season is brought on by the earth's tilted axis and its revolution around the sun. Therefore, option (D) is correct.




Why do we have seasons ?

The seasons are caused by Earth's tilted axis. Different regions of the Earth are exposed to the Sun's strongest rays at various times of the year. Therefore, the Northern Hemisphere experiences summer when the North Pole tilts toward the Sun. Additionally, winter in the Northern Hemisphere occurs when the South Pole tilts toward the Sun.

The Northern Hemisphere experiences summer in June because the Sun shines more intensely there than at any other time of the year. The Northern Hemisphere experiences winter in December because it is the month when the South Pole is oriented toward the Sun.

Therefore, option (D) tilted axis and revolution are reasons for the seasons.

Learn more about seasons, here:

https://brainly.com/question/923847



#SPJ5

In simple dominance, the dominant trait
a. is masked by the recessive trait
b. masks the recessive trait

Answers

Answer:

b. maks the recessive trait

Quick explanation:

The dominant trait masks the reccessive gene, but the person still has the gene, it just won't affect them, it might affect their future generations. For example, the trait for blue eyes is a recessive trait, so in order for you to have blue eyes, both parents will need to have the gene for blue eyes.

The correct answer is b!
Other Questions
(NEED HELP URGENTLY WILL MARK BRAINLIEST) "Confiscate" meansA. "a place where religious persons live in seclusion"B. "a person who does not have sex"C. "a kindness that God shows toward people"D. "to take something away as punishment" " 18 feet above ground level and 7 feet below ground level GIVING , and 1. The spores on a fern are found:in the fruitin the rootsunder the leavesinside the flowers2. Fern spores usually form during:springwintersummerfall3. Why must the plant which grows directly from the fern spore be wet?in order to produce a seedso that the egg can be fertilizedso that it can grow4. Spores are formed in:ovariesspore casesanthers5. Ferns grow by:photosynthesisreproductionmitosis6. How do spores help sustain the population of ferns?Spores do not have any natural predators.There are million of spores that are made by a single plant to help keep its population.Spores can hide under rocks for long time before maturing into an adult plant.Spores can live for a long time without maturing into an adult plant.7. Choose all the right answers.When the leaf of a fern touches the ground, it may produce a new plant:by planting a sporeby vegetative reproductionby growing roots at the point of contactby budding from its stem Ben and Jerry together own 75 comic books. If Ben owns 31 comic books, how many does Jerry own? Why was the second continental formed? Which of the following correctly uses a conjunction to form a compound sentence? We could go to the park, or we could ride our bikes. My sister likes to eat salad and fruit. Paul is wearing a scarf but not gloves. Cindy folded the towels, and Mom put them away. I have to earn good grades, or I wont graduate. you can pick more than one Drag each tile to the correct box.Identify the description of each cultural region.MidwestNorthwestSouthwestWest CoastIt is the center of US wheat,corn, and dairy farming.arrowRightIts culturally diverse population includesAfrican Americans, Anglo-Europeans,Latinos, and Asians. arrowRightThe use of Spanish-English bilingualismis more common than in other US regions.arrowRightAmerican Indian cultures such as the Inuitand Aleut remain influential in some areas.arrowRightReset Next Points B and B' have symmetry with respect to P. Find the coordinates of P when B is (2, 8) and B' is (2, 2). A. (2, 5) B. (0, 5) C. (5, 2) Which of these best describes the environment of the New England colonies? a)long, hot summers and mild wintersb)harsh winters, rocky and hilly landc)broad coastal plains and fertile soild)broad rivers, swamps Antonio is going to make a new summer drink. He needs 1/3 of a glass of orange juice and 2/4 of a glass of lime juice. The rest is water. To make one drink, what fraction of the glass will be water? Determine the number of real solutions each quadratic equation has.y = 12x2 - 9x + 4 What does domesticate mean? * plzzzzSelect the equation of the line that passes through the point (3,-1) and is parallel to the line on thegraph. (2 points)O y = -1O y = 3O y = x-1O y = 3x - 1 The Jackson-Timberlake Wardrobe Co. just paid a dividend of $1.55 per share on its stock. The dividends are expected to grow at a constant rate of 6 percent per year indefinitely. Investors require a return of 14 percent on the company's stock. a. What is the current stock price? (Do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16.) b. What will the stock price be in 3 years? (Do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16.) c. What will the stock price be in 7 years? (Do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16.) Tim has been saving for a down payment on a car. He invested $4,000 in an account earning 2.5% interest compounded semi-annually. After 7 years, he is ready to buy his new car. How much does he have in his account for a down payment? Round your answer to the nearest cent. Do NOT round until you have calculated the final answer. A pet store has 6 cats. Here are their weights (in pounds).6, 13, 9, 14, 5, 7Find the mean weight of these cats.If necessary, round your answer to the nearest tenth The molar mass of bismuth (Bi) is 208.98 g/mol.Calculate the mass in grams of a sample of Fli containing 7.35 x 1023 atoms.Write your answer using three significant figures.g Bi The majority of the debris found in the garbage patch is _______.a.large plastic bottlesb.sewagec.trash from landfillsd.small pieces of plastic Please help!!! Will mark brainliest if you show your work and the answer! What departments or programs have the best reputations?