what happened to the
beak depth of finches born in 1978 compared to those born in 1976? Explain why you
think this occurred.

Answers

Answer 1

Answer:

Why do you think the average beak depth of the birds increased?

Explanation:

Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.

I hope this helps!! god bless!! - Natalia


Related Questions

Astrology, look at the screenshot

Answers

Answer:

the day would get shorter.

hope it helps.

Answer:

year would get longer

Explanation:

PLZ HELP I"LL GIVE BRAINLIEST

Answers

Answer:

gotchu

Explanation:

1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)

2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal

b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster

3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.

4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women

5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD

6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids

A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).

Answers

Answer:

The allelic frequency for pointed ears is 0.5 (50%).

Explanation:

The frequency of alleles in a population must add up to 1 (100%).

The allelic frequency for pointed ears is 0.5 (50%).

What is allelic frequency ?

The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.

What is the difference between gene frequency and allele frequency?

Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.

To learn more about allelic frequency , here

https://brainly.com/question/23362399?referrer=searchResults

#SPJ2

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:


True or False.
A group of the same species of living things in an area is a population

Answers

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

what would the chromosome to the right be called?

Answers

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

What are the two resulting cells formed from single cell called

Answers

"Daughter cells" is the correct answerThe cell that splits is called the "parent cell" and the two cells that form are called the "daughter cells".Please let me know if I am wrong.

the question are in the Picture:) Please help me :) ​

Answers

Answer:

Birds

Explanation:

1. Wings

2. Flight feathers and beak

3. For survival purposes

PLZZ HELP IM DOING A UNIT ASSESMENT!!!!
What types of cells would contain cell walls and what types of cells would contain a cell membrane?

Answers

They have walls plants have walls

Answer:

I agree with the other person

have a good day :)

Explanation:

What do coal deposits tell you about the continents?

Answers

Answer:

Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.

What layer of the Earth does the upper surface of the cross-section represent? Group of answer choices Inner Core Outer Core Mantle Crust

Answers

Answer:

Hello! Your answer is...

The lithosphere is the rocky outer part of the Earth. It is made up of the brittle crust and the top part of the upper mantle. The lithosphere is the coolest and most rigid part of the Earth. The crust is the layer that you live in. The Outer and Inner Cores are hotter. The temperatures of the crust vary from air temperature on top to about 1600. The asthenosphere is the part of the mantle that flows and moves the plates of the Earth.

Explanation:

Hope this helps you! I'm new, but am really smart and nice. Hope you enjoy your time on brainly!

The crust of the Earth, the uppermost layer visible in a cross-section of the planet, is halfway through at this point. The crust, which only accounts for around 1% of the Earth's total volume, is made up of igneous, metamorphic, and sedimentary rocks.

What is the upper surface of the cross-section of Earth?

The rocky exterior of the Earth is known as the lithosphere. It is composed of the uppermost layer of the upper mantle and the brittle crust. You live in the crust of the earth. It is hotter in the outer and inner cores.

The crust varies in temperature from the top air temperature to roughly 1600. The Earth's tectonic plates are moved by the asthenosphere, a region of the mantle.

Therefore, Mantle Crust layer of the Earth does the upper surface of the cross-section represent.

Learn more about Earth here:

https://brainly.com/question/14491367

#SPJ2

what is the genotype for: A man normal for blood clotting:

Answers

Answer:

Genotypes: A man with hemophilia is XhY where h = hemophilia gene and H = the normal gene. ... Her genotype must be: XhXH and NOT XHXH We can use a Punnett square to show the probability of a daughter or son having hemophilia.

Which organism would look most like organism

Answers

Answer:

the last answer

Explanation:

because f,g,h both come from a so you can be sure

The North Pole and the South Pole are

A:Classified as tundra biomes

B: Not home to any animals

C: not classified into major biomes.

D: Part of Aquatic Ecosystems​

Answers

D part of aquatic ecosystems

Answer:

A

Explanation:

classified as tundra biomes

Hey My Name is Chloe, and I need some Help, But if you can't it's ok,

So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine

Answers

Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.

Explanation:

Answer: Animal: Bengal tigers

Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world?  Are bengal tigers being bred in captivity.

Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.

Explanation: I would suggest looking at national geographic if you want cooler animals.

Which of the following are prokaryotic cells?

A) plants

B) fungi

C) bacteria

D) animals

E) B and C only

Answers

fungi, bacteria

If I remember right, eukaryotic means there's more than one, so I believe this answer is right

The Answer is c: bacteria

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

7._________________________ lines your digestive tract and blood vessels. It moves food and blood through your body.

smooth muscle
skeletal muscle
cardiac muscle

Answers

Answer:

Smooth Muscle

Explanation:

In the digestive tract it's called the muscularis mucosa.

A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.

The weight of the man will...
Explanation...

Answers

Answer:

Increases.

Explanation:

A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.

why do people like sparkling water?

Answers

Answer:

maybe they think it will make them magical?

Explanation:

What is a simple diffusion?

Answers

Answer:

movement of a solute from an area of high concentration to an area of low concentration

Explanation:

What is the definition for polyploidy?

Answers

containing more than two homologous sets of chromosomes.

the ___severs as a relay station between the hindbrain and the forebrain.
A. forebrain

B. Midbrain

C.cerebral cortex

D. hindbrain

Answers

Answer:

B. Midbrain

Explanation:

I'm pretty sure this is it.

the answer is the midbrain cuz u can cross of forebrain and hindbrain and the cerebral cortex doesn’t apply so it’s B

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

What are the potential advantages and disadvantages of a major shift from the hard or traditional path of energy development to the soft or visionary path?

(These were the corresponding textbook pages, if needed) Please read the following from the textbook Environmental Science:
7th Edition - Chapter 17
9th Edition - Chapter 14

Answers

Answer:

Advantages of following the soft path, the argument here is alternative sources of power such as hydropower, geothermal energy , wind energy , and photovoltaic cells must be developed. This provides a alternative source to remain in a healthy environment and also function as the society we currently live in using the hard path.  Disadvantages of following the hard path result with future generations fearing over the irreversible damage of climate change and the damage done to our atmosphere. The hard path argue that we should continue to operate in the future as we have in the past, except more efficiently. This is close to impossible and will only continue the negative effects the hard path( the path we have been following) results in. The major shift determines the outcome of this world, the futures worries or reliefs and ultimately the survival of humans.

Explanation:

please help ::( i wanna pass w good grades

Answers

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

The coronavirus attaches to a membrane protein called

Answers

Answer:

M glycoprotein..

The coronavirus attaches to a membrane protein called M glycoprotein..

Which kind of worm is sometimes used to prevent blood clots?

planarian
leech
fluke
hookworm

Answers

Answer:

Leech

Explanation:

leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.

Answer:

a leech i got it correct on edu!

Explanation:

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

Each of the following is a density-dependent limiting factor EXCEPT:

- crowding
- predation
- competition
- disease

Answers

Answer:

predation

Explanation:

predation

I hop this answer is correct

Answer:

Disease

Explanation:

Other Questions
A shelf measures 0.45 feet long.How long does the shelf measure in inches and in yards?Enter your answers in the boxes.0.45 ft = ___ in.0.45 ft = ___ yd What connection does President Reagan make between freedom and progress? Support your answer with textual evidence and your own inferences. If a punch bottle says 10% fruit juice, and it is a 150 milliliter bottle, how many milliliters of fruit juice is in the bottle? Plzzzzz help need fast if cannn plzzz anota cada nombre en el recuadro correspondiente del globo terrestre Hi,can you check my answers please? what changed about art during the renaissance plis ayudaaaaaa que tenga explicacin y respuesta pero ayuda plisssss Could someone help me i dont understand it In this metabolic process, the enzyme RNA polymerase binds RNA nucleotides (the substrates) together by catalyzing the formation of a bond between the backbone sugar of one nucleotide to the backbone phosphate of another nucleotide. Name the metabolic process that bonds RNA nucleotides together Put "Polygenic Traits" in a sentence PLZ HELP!!! WILL GIVE HIGHEST POINTS IF THE ANSWER IS CORRECT!!! how many moles are in 1.505x10^24 molecules of surcrose Read the excerpt from "Pakistan's Malala." But what do you do when you're 11? You go to the playground and you play, so that's what they did. Some of the girls said they thought everything would work out. They'd be back, they said. Malala wanted to be hopeful, too. But before she left, she turned around and took one long look at the building. Malala was right about the edict and what it meant. After January 2009, she was forced to stay at home and read books, Ellick said. Eventually she was moved around the country where she attended ad-hoc schools. How did the setting of Malala's education change after the Taliban took over Swat Valley? She had to read at home or attend school in secret locations. She joined other children at the playground to read and study. She stopped trying to pursue an education in any way. She continued to attend the same school she had before. READ ALL PLEASESo I have been giving away pointsBut now that i have a lot I shall do another points give away yesNow hurry and add a answer :V Cells in both plants and animals use ______ to create energy, carbon dioxide, and water, when breaking down glucose in the presences of oxygen.A. Photosynthesis B. ATPC. Cellular Respiration D. Fermentation Using technology, determine the monthly payment on a 35 month loan of $28,000 at 8.1% compounded monthly. Round your answer to the nearest cent. Please select the best answer from the choices providedA. $900.90B. $875.02C. $1,102.94D. $1,012.10 #3 Write the fraction in simplest form 5/5 1. what is weather front?2.Name the instrument use to measure : (i)Wind speed (ii)Wind direction What did Secretary Reich take his campaign for a higher minimum wage to the press? Was this a good strategy?