What evidence in Courtney's data would most likely lead her to change the way she is conducting her study?

Answers

Answer 1

Answer: Her times at lunch were always faster, no matter what type of meal she ate.

Explanation:


Related Questions

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

You suggest using a logistic growth model instead. Your colleague agrees, and recommends harvesting the bass population down to just under carrying capacity. Their argument is that the population will remain large and population growth will be fastest if it is harvested down to this size. A) Why is this argument incorrect

Answers

Answer and Explanation:

The error of this argument is to state that a population will remain large and increase when it is close to the carrying capacity. This is because the carrying capacity is the term that determines that a population of living beings is living in an environment that has the minimum resources for their survival, because that population has already consumed the resources. In this case, when a bass population comes close to carrying capacity, the amount of environmental resources is starting to become scarce or limited, this will cause a decrease in the size of the population, because many members of the population will not have access to the necessary resources and will die, decreasing the population. In addition, reproduction among members of the population will be reduced, which will prevent the population from remaining large, since the mortality rate will be higher than the birth rate.

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

What is the slowest moving weather front. Why
is it so slow?

Answers

Answer:

Cold fronts

Explanation:

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

how did natural disasters affect animal populations?​

Answers

Answer:

When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need

Explanation:

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si

Which structure in the heart'separates
oxygenated blood from deoxygenated blood?

Answers

Answer:

pericardium

Explanation:

A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.

Please select the word from the list that best fits the definition

movement of molecules from an area where there are many to an area where there are few

Answers

Answer:

Diffusion

is the movement of molecules from an area where there are many to an area where there are few

Hope it helps

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

which statement is correct about the polarity of a water molecule

Answers

Answer:

Water is Polar

Explanation:

There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.

Water is polar good luck

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

The process of meiosis is illustrated here. The outcome of meiosis is very important in the sexual reproduction and life cycle of
diploid organisms. Evaluate these statements and determine which ones accurately describe the outcome of meiosis. You may select
ALL that apply.
-)
A)
Meiosis produces genetically diverse cells.
B)
Meiosis increases genetic variation in the offspring.
C)
Meiosis produces haploid cells from a diploid parent cell
D)
Meiosis increases the genetic content in the daughter cells.
E)
Meiosis maintains the number of chromosomes originally present in the
parent cell.

Answers

Answer:

A) Meiosis produces genetically diverse cells.

B) Meiosis increases genetic variation in the offspring.

C) Meiosis produces haploid cells from a diploid parent cell

Explanation:

Through crossing over, meiosis produces genetically diverse cells causing more genetic variation of offspring. The Daughter cells in meiosis are formed from a diploid cell that has all 46 chromosomes, however the daughter cells are haploids as they need to join with the other gamete to have a full set of chromosomes.

Other Questions
The price of a pillow was reduced from $80 to $60. By what percentage was the price of thepillow reduced Solve the following problem then write your answer before the number.1.)Rizza started cycling at 7:15 a.m. By 7:35 a.m,she had covered a distance of 9km.Find his average speed in km/h.2.)A car left Barretto at 10:50 a.m and reached Pampanga at 2:20 p.m.its average speed was 84 km/h.Find the distance between Barretto and Pampanga.3.)Aaron travalled 210 km at a uniform speed of 60 km/h.How long was his travel? PLEAES HELP 80 POINTS with branily I really need help and I will be forever in det to the person that helped me Bec this Is 40% of my grade And please don't steal my points I need them in doing a give away soon. :)On the coordinate plane shown below, points G and I have coordinates (6,4) and (3,2) , respectively.1)Design a strategy in which the Pythagorean theorem is used to calculate the straight line distance between points G and I2) on a coordinate plane. Use complete sentences to describe the strategy.Use the Pythagorean theorem to determine the distance between the two points on the coordinate plane. In your final answer, include all of your calculations.Use the distance formula and the coordinates of points G and I3) to prove that the Pythagorean theorem is an alternative method for calculating the distance between points on a coordinate plane. In your final answer, include all of your calculations. Study the graph showing GDP in the US.A line graph titled G D P Growth in the U S. The x-axis is labeled Year from 2004 to 2014. The y-axis is labeled Percent Growth from negative 4 to 6. 2004 is at 4 percent. 2006 is around 3 percent. 2007 is at 2 percent. 2009 is under negative 2 percent. 2010 is at 2 percent. 2012 is at 2 percent. 2014 is over 2 percent.What conclusion can be drawn about the US economy as a whole between 2006 and 2009?It remained level.It declined steadily.It wavered in growth.It rose from a downturn. Hey! Have a wonderful day!!! can someone explain how to do this? Describe 'The Beatles' in one word. Read the following passage:The agile youth sprang into the chariot, stood erect, and grasped the reins with delight, pouring out thanks to his reluctant parent.Based on the context, what does the word agile most likely mean?exceptionaleagerquickflexible Data from a 2006 GSS subsample show that the mean number of children per respondent was 1.87, with a standard deviation of 1.64. A total of 1,494 people answered this question. Estimate the population mean number of children per adult using a 90% confidence interval. We our 90% confident that the population mean number of children per adult is between to . Please round to the nearest tenth For example, rounding 0.843 to the nearest tenth would give 0.8. In what ways did the Mexican American War help fulfill Manifest Destiny? A medical equipment industry manufactures X-ray machines. The unit cost C (the cost in dollars to make each X-ray machine) depends on the number of machines made. If X machines are made, then the unit cost is given by the function C(x)=0.7x^2-462x+88218 . What is the minimum unit cost? You have a paid internship working in an after-school academic program. Your supervisor mentions that the program, and your position, are possible because of Title I. What can you logically conclude about your program?a. It employs traditional models of discipline and learning.b. It is composed of students from low-income families.c. It is the result of highly organized systems of data collection.d. It has a strong and dedicated teaching staff. Use the Daily Compounding chart in your book to answer the following question. Alana Geltner deposited $2,250 in a savings account that pays 5.5 percent interest compounded daily. How much interest did she earn after 130 days? What is the area of kite QRST? If necessary, round to the nearest tenth. do you think the increase of R10 towards the child support grants is enough? Sam loaned $8,000 to his brother to make a down payment on a new home. Threeyears later, he paid her back the $8,000 along with an interest of $900. If theinterest that was collected was simple interest, what was the annual interest rate?Round answer to two decimal places.I need help this one someone please I will Mark someone brainliest and if you post any links I will report you. help me please someone........... Shady rivers summer cam has 188 campers this week. If there are 22 campers to each cabin what is the fewest numbers of cabins needed Soil has a specific heat capacity of 1.700J/g C. During the day, the temperature of soil in aflowerpot increased from 15.6C to 35.5C. If the energy from the sun was calculated to be 251 175J,what was the mass of the soil? Show your work. Here are two patterns made using identical rhombuses. Without using a protractor, determine the value of a and b.