What effect would building a highway have on an ecosystem?
A) increase in butterfly migration
B) Decrease in destruction of a habitat
C) Increase in carbon dioxide
D) Increase in oxygen

Answers

Answer 1

Answer:

C

Explanation:

Building a highway destroys an ecosystem/habitat, so not b. With the ecosystem destroyed there will be a reduced number of trees that produce oxygen, so not d. Now you make an educated guess. If there is a large highway there will be a lot of cars which produce lots of carbon dioxide. No butterflies.

Answer 2

Answer:

Increase in Co2

Explanation:

More vehickes mpre Pollution


Related Questions


When can an acquired mutation be passed from parent to offspring

Answers

If the mutation takes place in a gamete that ends up forming an embryo, the mutation will be passed on to an offspring. This can also occur if the mutation occurs early in an embryos development, and the cell becomes one of the gamete forming cells, the mutation will be passed on to their offspring.

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

What is the slowest moving weather front. Why
is it so slow?

Answers

Answer:

Cold fronts

Explanation:

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

how did natural disasters affect animal populations?​

Answers

Answer:

When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need

Explanation:

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

Which wire, when current flows through it, would be surrounded by the strongest magnetic field?

A thin copper colored bar.
A copper colored coil with 2 turns.
A copper colored coil with 5 turns.
A thick copper colored bar.
Mark this and return Save and Exit

Answers

Answer:

A copper with 5 turns

Explanation:

Answer:the other guy is right

Explanation:

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer

One of the biggest sources of greenhouse gases released into the
atmosphere is emissions from burning fossil fuels. How could carbon
sequestration help alleviate problems associated with burning fossil fuels?
A. It could make fossil fuels a clean-burning energy resource.
B. It could prevent carbon dioxide from being a greenhouse gas.
O C. It could prevent released carbon dioxide from entering the
atmosphere.
D. It could make fossil fuels a renewable energy resource.

Answers

Answer:

The correct answer is - B. It could prevent carbon dioxide from being a greenhouse gas.

Explanation:

Carbon sequestration is the process that involves capturing and removal of atmospheric carbon dioxide from the atmosphere and prevent it from changing climate by increasing global warming as carbon dioxide gas traps the heat.

It is helping in the removal of excess carbon dioxide from the atmosphere and prevents it from being a greenhouse gas and increase global warming. It could be geological or biological.

Answer: C- it could prevent released carbon dioxide from entering the atmosphere

Explanation: ap3x

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

which statement is correct about the polarity of a water molecule

Answers

Answer:

Water is Polar

Explanation:

There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.

Water is polar good luck

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

Some cells release active signaling proteins when membrane-bound precursor proteins are cleaved by proteolytic enzymes. The signaling proteins can then bind to receptors on the surface of a target cell, thereby activating an intracellular signaling pathway and eliciting a response from the target cell. This mechanism of activating receptor-binding signaling proteins has been observed in a variety of organisms from bacteria to humans. Many of the enzymes responsible for proteolysis of membrane-bound precursor proteins have been isolated and characterized.


Required:

What questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species?

Answers

Answer:

Following questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species:

Are the genes encoding the proteolytic enzymes expressed in the same cell types in all species?  Once the precursor proteins of different species are cleaved, do the active signaling proteins bind to  the same receptors on different target cells? If a proteolytic enzyme from one species is incubated with a precursor protein from another species, does correct cleavage occur? Are the proteolytic enzymes synthesized in the rough endoplasmic reticulum of all species?

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell
Other Questions
1) Did Americans originally support the Boston Tea Party? Why or Why Not?2) Who,besides Paul Revere, rode to warn the colonists about the British?3) What was the original powerful first paragraph of the constitution about? What was it replaced by and why?4) How did the French help the colonists win the Revolutionary War?5) Who is Molly Pitcher and what is her story?Was she a real person?6) What country was the state of liberty originally for? What did the lantern stand for? Why did some people protest against the statue?7) Why did you think we were told these Read the two stories.Story 1:Amelia could not find her dog, Rocky, so she started to look for clues. She searched the fence and discovered a large, muddy hole under one section. She crawled through the hole and walked toward the neighbors house. Muddy paw prints covered the porch steps. Amelia knocked on the back door and suddenly heard a bark. She had found her dog.Story 2:For the science fair, Peter was measuring how sunlight affected plants. Each day he watered his plants and tracked their progress. One day, he noticed that all the plants were starting to droop. Something was fishy, so Peter began to investigate. He discovered soapy water on the table. Soapy water is harmful to plants. He waited after school and hid behind a desk to see if someone was messing with his plants. Ten minutes later, he saw Emily enter the room, make a soapy mixture, and pour it into the plants. She was caught red-handed.Which statement about the theme of both stories is true? A. The theme of both stories is that solving a problem takes a lot of time. B. The theme of both stories is that the key to solving a problem is using your mind. C. The theme of Story 1 is that the key to solving a problem is using your mind; the theme of Story 2 is that solving a problem takes a lot of time. D. The theme of Story 1 is that solving a problem takes a lot of time; the theme of Story 2 is that the key to solving a problem is using your mind. plz help.....Match a verb in A with a word or phrase in B URGENT PLEASE ANSWER!!(To Kill a Mockingbird)Give some indication that Scout is growing up as related to her own opinions about things. Why was hatshepsut concerned abt creating a myth Identify the acid, base, and salt in the following reaction HNO3 + KOH > H2O + KNO3 GIVING BRAINLIEST AND EXTRA POINTS!!!!! :DWhy were the french willing to sell the Louisiana Territory to the United States? Why did the United States wanted to purchase the Louisiana Territory form the french? please help A video game box is shaped like a rectangular prism with the following dimensions Length = 20 in Width = 8.25 in. Height = 4.5 in. What is the volume of the box in cubic inches? Solve the quadratic equation by using either a numeric or a graphic approach. x^2-14x-49=0A. X= -11.1 or x=-12B. X=12.3 or x=-10.82C. X=16.9 or x=-2.9D.X=1 or x=-3 Find the midpoint of the segment below and enter its coordinates as anordered pair. If necessary, express.coordinates as fractions, using the slasmark ( / ) for the fraction bar.(-4,3) (-4,-3) what are some of the amazing aspects of the monarchs annual migration? (site 1) What are syllabic Japanese scripts, that were devised to deal with the elements of pronunciation that could not be written with the borrowed Chinese characters known in Japan as kanji ()?A] Hanging scrollsB} MandalasC} HandscrollsD} Kana syllabary Plz help have to turn in today Genetic engineering techniques can be used when analyzing and manipulating DNA and RNA. Scientists used gel electrophoresis to study transcription of gene L and discovered that mRNA strands of three different lengths are consistently produced. What explanations best accounts for this experimental result? i need help now, The rectangle and the trapezoid have the same area. What is the length l of the rectangle? What is the value of this expression?14 + 6 x (9-6)Plz helppp Help meh please!Which life skill can be used to chart your course to peak performance? a.communication skills b.goal setting c.reading d.negotiation plz help solve, velocity units are ft/min what is the value of x Colin slices a cake into 8 equal-sized slices. He and his friends eat 5 slices of the cake.What fractional part of the cake do Colin and his friends eat?