what are 5 factors needed to support life(actually list the please)

Answers

Answer 1
Water, Oxygen, Food, Heat, Pressure

Related Questions

what is the relation between weight of the body and weight of the heart​

Answers

300g in males 200g in females

Which phrase describes one main feature of the atmosphere

Answers

Answer:

protects earth's surface

I hope this helped you!

(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?

Answers

Answer:

Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.

Explanation:

Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!

If 5x+4y=58 and 3x + 7y = 67 find the value of ( x + y ) ​

Answers

Explanation:

5x + 4y = 58 ....1

3x + 7y = 67 ....2

....1 × 3 both sides of the equation

15x + 12y = 174 ....3

....2 × 5 both sides of the equation

15x + 35y = 335 ....4

.....4 - ......3 both sides of the equation

35y - 12y = 335 - 174

23y = 161

y = 161/23

= 7

Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?

Answers

Answer:

DNA ligase

Explanation:

Answer: The nucleus

Explanation: I got it right on the test.

Compare and contrast DNA to RNA, mention 3 points

Answers

Answer:

RNA is single-stranded while DNA is double-stranded. RNA contains uracil while DNA contains thymine. RNA has the sugar ribose while DNA has the sugar deoxyribose.

Please mark me as brainlist.

Answer:

Differences -

DNA is made of sugar deoxyribose, RNA is made of sugar ribose

DNA is a double-stranded molecule, RNA is a single-stranded molecule

DNA is stable under alkaline conditions, while RNA is not stable

DNA stores genetic material, RNA converts information from DNA to proteins

Similarities -

Both store genetic infrmation

Both DNA and RNA consists of sugar, nitrogenous bases, and a phosphate backbone

Explanation:

What speed do thorn bugs move at?

Answers

Answer:

they are not built for speed, and often move quite slowly.

Explanation:

<3

They often goes slow.

Help I don’t get it the last one says negative

Answers

Answer:

Negative (Fourth Choice)

Explanation:

According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.

Number 15 which of the following is a function of carbohydrates?

Answers

Answer:

Option (c) cell wall.  

Explanation:

Carbohydrates helps to forms the cell wall.  Cellulose is a carbohydrate and it is found the plant cell wall.

You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment

Answers

Answer:

C. Hypothesis

Explanation:

Is it possible for you to be more related to one grandparent than another?

Answers

Answer:

No because you should get half the DNA from your parents meaning you should be related to the grandparents equally

Answer:

The question isn't clear, can you restate it ?

Explanation:

Which statement is true? a. Earth’s revolution is circular. b. Earth’s revolution is elliptical. c. Earth’s distance from the Sun is constant. d. Earth’s average distance from the Sun is 2 astronomical units.

Answers

Answer:

B

Explanation:

How many atoms of each element are in the chemical formula NH4NO3?

1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen

Answers

C - 2 Nitrogen / 4 Hydrogen / 3 Oxygen

hope that helps :)

Which specialized cell type would be found lining the trachea, the part of the body that brings air to the lungs?
A)blood
B)epithelial cells
C)neuron
D)muscle cells

Answers

Answer:

epithelial cells

Explanation:

I hope it works <3

Answer:

Blood

Explanation:

Red blood cells are responsible for transporting oxygen to the different parts of the body.

Which statement does NOT accurately describe eukaryotic and prokaryotic cells?

Answers

Answer:

You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.

For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.

Prokaryotic cells are found in the domain(s) Bacteria and Archaea.

True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.

A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.

There is only  _1_ eukaryotic domain, it is Eukarya.

Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?

A.Electron
B.Neutron
C.Nucleus
D.Proton

Answers

Answer:

Nucleus

Explanation:

explain how matter behaves differently than energy in a ecosystem

Answers

Answer:

Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.

HELP IDK THE ANSWER SKSK

Answers

Answer:

The Goldilocks Zone?

Explanation:

The Goldilocks zone is a region that is close enough to the Sun to get the energy, and far enough to not burn up.

Answer: pretty sure thats right

Explanation:

HELPPPPPP ME PLEASEEE

Answers

Answer:

building blocks of life

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. 

Which molecule is a source of carbon, hydrogen, and oxygen atoms for making proteins?
O water
O salts
O carbohydrates
O carbon dioxide

Answers

Carbohydrates is your answer because it’s the only molecule that provides energy of the 4 options

What molecules will carry the electrons to the electron transport chain?

Answers

Answer:

electron and nuetrons

The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.

These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.

The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.

Learn more about the electron transport chain, here:

https://brainly.com/question/33834922

#SPJ4

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

1. Why were populations able to get so big? What happened that allowed this to happen?

2. What do you think will happen if the populations of humans continued to increase

3. What could happen that could limit the population or cause it to decrease ( Stop growing )

Answers

Answer:

1. reproduction

2. we could run out of food as not enough is produced fast enough

3. lack of food, women and men who are infertile or diseases which can kill people

Which of the following actions would you take to remain safe in the lab?
Check all of the boxes that apply.

A bottle of liquid looks like water; you taste it to be sure.

While cutting a screen for an aquarium top, you point the scissors away from your body.

You pipette a liquid using a bulb pipette.

You heat a liquid by placing it in a plastic beaker on a hot plate.

You arrange all lab items neatly and make sure they are away from the edge of the lab table.

Answers

You arrange all lab items neatly and make sure they are away from the edge of the lab table.

You pipette a liquid using a bulb pipette.

The following guidelines should be included in most safety policies because they apply to practically all laboratories. They go on emergency preparedness, appropriate signs, safety gear, how to use lab equipment properly, and fundamental common sense standards.

Make careful to read any safety and fire alarm signs, and in the event of an accident or emergency, heed the directions.Make sure you are completely informed of the evacuation protocols for your building or facility.Make sure you are familiar with the location and proper use of all of the safety supplies in your lab, including eye wash stations, fire extinguishers, first aid kits, and safety showers.Be aware of the emergency phone numbers to call for assistance.Lab spaces with lasers, radioisotopes, and other biohazards need to be adequately labeled with warning signs.When working in the lab, avoid eating, drinking, and chewing gum.Never use laboratory glassware as a container for food or drink.Make sure to inspect your glassware for chips and cracks before each usage. Glassware that is broken should be reported to your lab manager so it can be disposed of properly.Never utilize lab equipment that you have not been given permission or been taught to use by your supervisor.Inform a technician as soon as possible if an instrument or piece of equipment malfunctions while in use or isn't functioning properly. Never attempt to fix a piece of equipment by yourself.

To know more about Lab guidelines visit:

https://brainly.com/question/2232090

#SPJ1

Describe one way the plants in a desert biome are adapted to survive?​

Answers

Answer:

The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.

Explanation: I hope this help's you some!!

write the names of Institute which involved in research of viruses
plz tell me fast​

Answers

Answer:

The National Institute of Virology, Pune is an Indian virology research institute, and one of the translational science cells part of Indian Council of Medical Research (ICMR). It was previously known as 'Virus Research Center' and was founded in collaboration with the Rockefeller Foundation.

HELP ASAP 20 POINTS!!!!!!!!!!!!
2 ANSWERS

Answers

Answer:

A, and D

Explanation:

its the answer I believe

Answer:

Nitrogen, Calcium

Explanation:

im pretty sure.

Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle

Answers

The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Glycolysis

Glycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.

Citric acid cycle

This is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.

Acetyl CoA formation

The pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.

Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539

Answer:

It's B

Explanation:

I took one for the team.

when is hypothesis accepted as a theory by the scientific community

Answers

Answer:

A hypothesis is an idea that hasn't been proven yet. If enough evidence accumulates to support a hypothesis, it moves to the next step — known as a theory — in the scientific method and becomes accepted as a valid explanation of a phenomenon.

After transcription, the new mRNA strand travels to the cytoplasm and over to the ___________ where the genetic code will be translated into amino acids.

nucleus

cell membrane

ribosomes

golgi bodies

Answers

The answer is C ribosomes

After transcription, the new mRNA strand travels to the cytoplasm and over to the RIBOSOMES where the genetic code will be translated into amino acids.

During gene transcription, a specific fragment of DNA called gene is used to produce a complementary messenger RNA (mRNA) sequence in the cell nucleus.

Subsequently, this mRNA travels to the cytoplasm where it is used as a template to synthesize a polypeptide chain in the ribosomes by a process called translation.

Ribosomes are protein factories that read the genetic code in the mRNA sequence (i.e., the codons of the mRNA) to translate it into the correct order of amino acids of the protein.  

In conclusion, after transcription, the new mRNA strand travels to the cytoplasm and over to the RIBOSOMES where the genetic code will be translated into amino acids.

Learn more in:

https://brainly.com/question/241631?referrer=searchResults

Other Questions
What best describes the way in which German colonies became involved in the war?O They actively sought to become involved in the war to strengthen their status and power in GermanyO They were given the option for fighting with Germany or with the Allies, and they sided with the AlliesO They eventually decided to become involved as it became clear that Germany needed more soldiers.O They had no say in whether they would fight in the war or for which side they would fight 4. Jimmy likes to work with his friend Joe in 7th grade science class labs. However, he notices that he tends to get lower grades when he does work with Joe, because he and Joe like to talk about basketball and not science. He's decided to investigate if his science lab grades are higher when he works with Joe or if they're higher when he works with someone else. He has set goals to become a better student, so help him write a hypothesis for his study. a. Manipulated variable b. Responding variable Read this excerpt from The Raven.here I opened wide the doorDarkness there and nothing more.Deep into that darkness peering, long I stood there wondering, fearing,Doubting, dreaming dreams no mortals ever dared to dream before;But the silence was unbroken, and the stillness gave no token,And the only word there spoken was the whispered word, "Lenore?"This I whispered, and an echo murmured back the word, "Lenore!" Merely this and nothing more.Which best describes the imagery the poet is creating in this excerpt?The speaker goes to his bedroom door, opens the door, and finds his lover Lenore standing in the dark on the other side.The speaker opens his bedroom door into darkness and there is nothing there so he closes the door quickly and runs back to bed.The speaker opens his bedroom door, stands there a while, whispers into the darkness, Lenore, and hears this word echo softly but nothing more.The speaker opens his door as fast as he can to run into his room, away from the scary darkness in the hallway that has no lighting. Is there enough information given to prove that the following pairs of triangles are congruent explain why or why not if not describe the information could be added to guarantee congruence 0.00062 as a scientific notation What is the value of the expression 5y2 + 4x when x = 2.5 and y = 3? consider the equation 8x+4y=64 where does the graphs intersect the x-axis ?provide the coordinate point below ( , ) Whats scarier clowns or demons?(Pennywise,poltergeist clown,twisty,jack-in the box)(Mara,Polaroid,dont knock twice,Annabelle,Conjuring) One month, an animal shelter places 2/5 of its animals into foster care. If there were 45 animals at the shelter that month, how many were placed in foster care? Please help because this is timed! A student looking for an element that will bond with sodium (Na) knows that table salt is a compound of sodium and chlorine (Cl). Based on this information, which of the following elements would MOST likely bond with sodium?A.argon (Ar)B.bromine (Br)C.calcium (Ca)D.potassium (K) WhatWhat does the Columbia river and its tributaries provide for the people of Washington Which force keeps planets in orbit around the Sun?O A. Strong nuclear forceO B. Electric forceO C. GravityO D. Magnetic force In triangle ABC, the measure of angle B is 50 degrees. Select all possible values for the measures of A and C if ABC is an acute triangle. m\angleA= 58 degrees; m\angleC= 72 degrees m\angleA= 100 degrees; m\angleC= 30 degrees m\angleA= 80 degrees; m\angleC= 50 degrees m\angleA= 60 degrees; m\angleC= 70 degrees m\angleA= 90 degrees; m\angleC= 40 degrees m\angleA= 105 degrees; m\angleC= 25 degrees Question 13(Multiple Choice Worth 1 points) (8.03 LC) A set of equations is given below: Equation C: y = 7x + 12 Equation D: y = 7x + 2 How many solutions are there to the given set of equations? One solution Two solutions Infinitely many solutions No solution x-13=62 idk know it Explain why being wealthy is an advantage when running for office The area of the top face of a cube is 16 square inches. Use 8 of these cubes to make a rectangularprism. What is the volume of the rectangular prism? Hint: The shape of each face of a cube is asquare. PLEASE HELPP!!!!! Will mark you as Brainliest!!!! How many liters are in 260 ounces? GET BRAINLIEST IF YOU ANSWER THESE QUESTIONS!!1.What were the names of the two great civilizations that the Spanish conquered whose territory is located in present day Mexico and Peru? 2.Short Answer: Based on what you have learned from this unit on European Exploration, explain how exploration can lead to both positive and negative effects for different populations/nations. (Use examples in your answer.)