Two disease affecting rabbits

Answers

Answer 1
Overgrown teeth.
Snuffles.

Related Questions

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Drag each label to the correct location.
Identify the types of clouds shown in the image.
altocumulus
Cirrus
stratus
high
clouds
middle clouds
low clouds
middle
clouds

Answers

Answer:

The high clouds are cirrus,

The middle clouds are cumulus,

And the low clouds is stratus.

Explanation:

High clouds are cirrus, middle clouds are cumulus, and the low clouds are stratus.

What are the different types of clouds?

There are several types of clouds, classified based on their height, shape, and composition. Here are the main types of clouds:

Cirrus clouds: Thin, wispy clouds high up in the atmosphere, composed of ice crystals.Cumulus clouds: Puffy, white clouds that can resemble cotton balls. Stratus clouds: Low-level clouds that form a uniform, gray layer in the sky. Alto clouds: Middle-level clouds that are composed of water droplets and sometimes ice crystals. Cumulonimbus clouds: Towering clouds that can reach high into the atmosphere, often associated with thunderstorms, heavy rain, hail, and lightning.Stratocumulus clouds: Low-level clouds that are often arranged in rows or patches, resembling scales or fish scales.Nimbus clouds: These are dark, gray clouds that are associated with rain or snowfall.

Thus, the high clouds in the image are cirrus, the middle clouds are cumulus, and the low clouds are stratus.

Learn more about clouds, here:

https://brainly.com/question/1558130

#SPJ5

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Which of the following cells would be found in connective tissue?


Osteocytes


Goblet cells


Mucous cells


Neuroglial cells

Answers

Explanation:

the common cell types in connective tissue include: fibroblasts, mast cells, plasma cells, macrophages, adipocytes, and leukocytes. Slide 72 Tendon. Fibroblasts are the most common cell type of connective tissue. They produce both fibers and amorphous ground substance.


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

What is the greenhouse effect?


A
Greenhouse gases trap in oxygen and warm Earth.

B
Greenhouse gases trap infrared radiation and warm Earth.

C
Greenhouse gases trap UV radiation and cool the Earth.

D
Greenhouse gases trap carbon dioxide so plants can grow.

Answers

Answer:

B.

Explanation:

due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

If all grasshoppers are removed from the food chain, what will happen to the blue birds

Answers

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

Answer:

If all grasshoppers are removed from the food chain...the bluebirds will decrease in numbers.

Explanation:

I hope that this has helped you to understand your question. If you have any further questions, please put them below.

Have a great rest of your day/night!

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

What is climate change? O A. Lange-scale changes to weather patterns B. Increasing temperatures only C. Natural cycles of cooling and heating D. Decreasing temperatures only ​

Answers

Answer:

C. Natural cycles of cooling and heating is the best option.

Explanation:

C. is the only answer that describes climate, the others describe weather. Climate is natural conditions over a long period of time while weather is over a short period of time.

Please give brainliest.

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.

Answers

i believe it is true
If haves to be true

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

Other Questions
4. According to legend, what are the two most likely reasonsGeneralJohn A. Logan chose May 30 to be Decoration Day? After sitting on a shelf for a while, a can of soda at room temperature (73 F) is placed inside a refrigerator and slowly cools. The temperature of the refrigerator is 35 F.The can of soda reaches the temperature of 53 F after 35 minutes. Using this information, find the value of k, to the nearest thousandth. Use the resulting equation to determine the Fahrenheit temperature of the can of soda, to the nearest degree, after 70 minutes. Select the correct answer. What is the solution of this system of equations? y = 3x + 5 y = -x + 3 How do you write balance equations Fe2 S3+O2-Fe2O3+SO2 Can some one help me with this question its hard :( down below ill give brainliest Say what the following people are doing now that is different from what they normally do. Ejemplo: Generalmente, Juan maneja despacio. Ahora est manejando rpido.Normalmente, Diego dice mentiras. Ahora __________ la verdad.Cada da los peatones no siguen por aquella avenida. Hoy s ______ por aquella avenida.Generalmente, repetimos las direcciones cuando las recibimos. Ahora no ______ nada.En un da normal, los peatones se visten de amarillo. Hoy da los peatones _____ de anaranjado.Normalmente, Uds. leen el manual de manejar. Ahora Uds. no _____ el manual.Liliana cruza la calle con su mam todos los das. Pero ahora no ______ la calle porque est sola.Siempre traigo mi permiso de manejar. Hoy no ____ el permiso conmigo.Normalmente me pones tranquilo. Ahora ______ nervioso.Generalmente, Andrs duerme en casa. No s por qu ahora _____ en el coche.En este restaurante siempre pedimos la paella. Pero esta noche _______ la tortilla espaola. 11Solve for A, B, and C:3a Find the area of this trapezoid.A. 240 cm2B. 288 cm2C. 312 cm2D. 336 cm2 NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP if you had a choice beetween sleeping in a huanted house or get attacked by 3 wild dogs what would it be PLEASE HELP ME!I NEED ANSWERS NOW! NO FILES!A group of students makes a toy rocket for a physics class. The function h(t) = -16t2 + 96t + 1 models the flight of a toy rocket, where h(t) is the height of the toy rocket in feet after t seconds.Part A: What is the maximum height of the toy rocket?Part B: After how many seconds will the toy rocket reach its maximum height?Part C: The students make some modifications to the toy rocket and it is launched a second time in hopes of making the rocket fly higher. This time the rocket's flight is given by the equation: h(t) = -16t2 + 80t + 3. Did the rocket fly higher the first or second time? Explain how you know this. Katie is camping with her family. She forgot her gloves. Now her hands are cold.How can Katie keep her hands warm?OAKatie can stick her hands in cold water..Katie can hold a flashlight in her hands.OC.Katie can rub her hands together.OD. Katie cannot make her hands warm. PLSS HELPA paper store spent 1/4 of all the money they earned in December to buy new inventory. It used 1/2 of the rest of the money to pay bills. Then, they still had $3,000 left over. How much money did the store earn in December? Expand and simplify4(2a + 4b) + 3(2a + 2b) the question is on the picture Question 6 of 15Which of the following is a polynomial? Ill mark brainliest for anyone who answers. Would you rather be forced to listen to the same 10 songs on repeat for the rest of your life or forced to watch the same 5 movies on repeat for the rest of your life? Which expression means "10 less than the sum of a and b"? What African country was the site of colonization efforts for freed slaves?