The Middle Passage considered enslaved africans as:
A-equals
B-family
C-indentured servants
D- property
ps. I know it’s not the first two thanks for your help<3

Answers

Answer 1
Most likely property due to them being slaves

Related Questions

21. How is the Executive elected?​

Answers

Answer:

on the first Tuesday in November of every fourth year, the people elect the members of the Electoral College. Apportioned by population to the 50 states  one for each member of their congressional delegation

Explanation:

Answer:

The citizens

Explanation:

The President is elected by the entire country and serves a four-year term. The President approves and carries out laws passed by the legislative branch. He appoints or removes cabinet members and officials.

the columbian exchange can trace its development to

Answers

Explanation:

voyages of European discovery in the 15th and 16th centuries.

The Columbian Exchange can trace its development to voyages of European discovery in the 15th and 16th centuries. The exchange of plants, animals, people, and ideas transformed the globe.

in the system of feudalism who owns the land

vassals or knights
peasants
knights or lords
priests

Answers

Peasants is the answer

Answer:

Peasants

Explanation:

That is the answer, hope you have a great rest of your day

A polar bear has thick, white fur that camouflages it when it sits on snow. Which type of adaptation is this modification?
A. structural
B.natural
C.functional
D.behavioral
Which on is it?

Answers

Answer

I think its C, functional

Explanation:

Partly because of the effects of AIDS on Botswana’s adult population, the majority of the country’s population is

Answers

Answer:

D. under 20

Explanation:

hoped it helped

Helppp please
Which detail foreshadows Mama getting fired?
O Mr. Jamison warning Papa about the Wallace's plan
the mud hole that broke the school bus
Ο Ο
the nightmen pulling into the Logan's driveway
O Miss Crocker's reaction to Mama fixing the school books
Question 5

Answers

Answer:

Miss Crocker's reaction to Mama fixing the school books

Explanation:

im about to submit this test, this is what ill put, ill let you know if its right

Answer:

Miss crockers reaction to Mama fixing the school books

Explanation:

Submitted this and got it correct! :)

Where could convection currents form?

in a sand dune
on a pavement
in the atmosphere
in outer space

Answers

Answer:

In the atmosphere

Explanation:

edge2020

Convections currents are formed in the atmosphere.

What are convection currents?

This is the system that has to do with the movement of energy from one form to another form.

Convection currents are known to exist in the atmosphere that they are found. This is also refer to as the convection of heat transfer.

Read more on convection here: https://brainly.com/question/9382711

If there is too little supply of a product, then production would be

decreased
increased
the same
none of the above

Answers

it would be increased. hope this helps!

every new years eve people burn tires with the belief that this will drive evil spirits away and will add fun to their merry
making. How will you explain to
your family or neighbors that this is
good practice?​

Answers

Answer:y utilizó diversas estrategias narrativas para escribir sobre la violencia,

tan presente en su realidad, tan presente en nuestra realidad. Cervantes, con su forma de ver y contar el mundo, se convirtió en el hilo de

Ariadna que mantiene unida una gran parte de la literatura desde su

tiempo hasta el nuestro y daremos de ello buena cuenta en las páginas

que siguen a continuación.

Tratar de analizar la presencia de la violencia en la literatura, aunque sea en un ámbito restringido como es el hispánico, es una tarea ardua y prácticamente inabarcable. Se podría decir que es un fenómeno

ambiguo, dual, ya que, por una parte, ha repugnado a la humanidad

desde tiempos remotos, y por otra, no ha dejado nunca de ejercer fascinación. El ejercicio de la violencia ha sido denunciado y censurado;

y, sin embargo, no se ha dudado en legitimarlo e institucionalizarlo

cuando así se ha estimado oportuno: la historia y la literatura son testigos elocuentes de ello.

Los estudios que se recogen a continuación abordan este complejo

y apasionante tema: el de las expresiones de la violencia en las letras

hispánicas durante los siglos XX y XXI, desde presupuestos muy diferentes. De la suma de todos ellos se podrá formar una visión global

de un tema que parece inagotable. Sin duda, la violencia, lo oscuro,

nos atrae y esta fuerte atracción que sentimos se traduce en la variedad

de manifestaciones que la literatura nos ha ofrecido en el tiempo y el

espacio hasta nuestros días.

C

Explanation:

The
are bodies of rock or gas that are named for ancient gods.


are made of rock or metal, which often collide with Earth.

The
are most similar to Earth.

The Juno probe is exploring the planet
.

Answers

Answer:

planets

meteoroids

terrestrial planets

Jupiter

Explanation:

The planets are bodies of rock or gas that are named for ancient gods.

Planets are astronomical bodies. They can be found orbiting stars with gravity. The Earth that we live on is a planet. It is also part of the Solar System which consists of eight planets. All these planets, besides Earth, have the names of ancient Roman and Greek gods and goddesses.

Meteoroids are made of rock or metal, which often collide with Earth.

Meteoroids are space bodies made from various materials. They are smaller than asteroids, usually going up to one meter. They often collide with the Earth but do not cause damage as the atmosphere shreds them until they are no longer dangerous. When people see meteoroids with the naked eye, they call them shootings tars.

The terrestrial planets are most similar to Earth.

These types of planets are composed of rock and metals, which means they have solid surfaces. They are, therefore, similar to the Earth. In our Solar system, terrestrial planets are Venus, Mercury, and Mars.

The Juno probe is exploring the planet Jupiter

Juno is NASA’s spacecraft sent into space in 2011. to explore Jupiter. It should measure its gravity and magnetic fields, and to offer us knowledge of how Jupiter builds, what does it look like, what is in its the core, temperature, etc. Name Juno comes from Roman mythology; goddesses Juno was the wife of the chief god Jupiter.

.

Answer:

The  

✔ planets

 are bodies of rock or gas that are named for ancient gods.

✔ Asteroids and meteoroids

are made of rock or metal, which often collide with Earth.

The  

✔ terrestrial planets

are most similar to Earth.

The Juno probe is exploring the planet  

✔ Jupiter

Explanation:

I got them all right, I copy and pasted so you can see the checks :)

Let’s say the average GDP per capita for the world’s countries is $10,500. The GDP per capita of Country B is $10,000. The majority of the workforce is in tertiary-sector jobs.


What is most likely about Country B’s economic development?

A.

Country B has a developed economy.

B.

Country B has a developing economy.

C.

Country B has a least-developed economy.

D.

We can tell nothing about the economic development of Country B.

His image shows the rock cycle.Which event most likely occurs at point V? QUICK I HAVE TIMER PLZ HELP :(

Answers

Answer:

The most likely about Country B’s economic development is:

C.  Country B has a least-developed economy.

Explanation:

aking into account the information given, the GDP of the country B is less than the world average, but its difference is just $500, reason why couldn't say that the country B has a developing economy which is characterized by GDP actually low, other reason of this is that its workforce is in the tertiary-sector jobs, while a country with a developing economy has a big part of his workforce in the primary-sector.

Answer:

B is the correct answer.

Explanation:

Plants can use sunlight energy in producing their own food and are examples of autotrophs. Do all autotrophs use sunlight energy to produce their own food? Explain why or why not.

Answers

Some autotrophs use sunlight energy to produce their own food. This is because autotrophs use a process called photosynthesis to make their food. This process uses energy from the sun, as well as water from the soil and carbon dioxide from the air to create glucose.

However, other autotrophs perform chemosynthesis, which does NOT require energy from the sun to produce food.

Overall, not all autotrophs use sunlight energy to produce their own food, but a large chunk of them do.

A few autotrophs use daylight energy to create their own food. This is on the grounds that autotrophs utilize an interaction called photosynthesis to make their food. This interaction utilizes energy from the sun, as well as water from the dirt and carbon dioxide from the air to make glucose.

What is an Autotroph?

An autotroph or essential maker is an organic entity that produces complex natural mixtures (like sugars, fats, and proteins) utilizing carbon from straightforward substances like carbon dioxide.

The essential makers can change over the energy in the light (phototroph and photoautotroph) or the energy in inorganic substance compounds (chemotrophs or chemolithotrophs) to construct natural atoms, which is normally amassed as biomass and will be utilized as carbon and energy source by different organic entities.

A few organic entities depend on natural mixtures as a wellspring of carbon, however can involve light or inorganic mixtures as a wellspring of energy. Such life forms are mixotrophs. A life form that gets carbon from natural mixtures yet acquires energy from light is known as a photoheterotroph, while a living being that acquires carbon from natural mixtures and energy from the oxidation of inorganic mixtures.

Therefore There are various sorts of essential makers out in the World's environment at various states.

Learn more about Autotrophs here:

brainly.com/question/11209881

#SPJ2

A document signed in 1689 that guaranteed the rights of the english citizens

Answers

Answer:

The English Bill of Rights.

Explanation:

An increasing federal deficit will likely put an end to__________
A. Categorical grants
B. Revenue sharing
C. Unfunded mandates
D. Devolution

Answers

Answer:

Revenue Sharing

which computer based model do psychologists use to explain the learning process in humans ?
A. cognitive processing model
B. information processing model
C. memory processing model
D. sensation processing model

Answers

Answer: information processing model

Explanation: got this answer right on edmentum

outline and explain two ways in which the personal life perspective contrasts with the traditional perspectives on their views of family ​

Answers

Answer:

The Personal Life Perspective argues that sociologists should study family life from the perspectives of individuals, and focus on what families mean to them. If people believe that pets and dead relatives are part of their family, the sociologists should accept this.

Conflict theorists agree that the family serves the important functions just listed, but they also point to problems within the family that the functional perspective minimizes or overlooks altogether. First, the family as a social institution contributes to social inequality in several ways.

Explanation:

Which of the following is not a stick used in foreign policy-making?

Answers

Answer:

what are the options?

Explanation:

What are the two main Mississippian Native American groups that lived in Georgia?

Answers

Answer:

Many remnant populations came together to form historically known native groups such as the Creeks, Cherokees, and Seminoles.

Explanation:

How do I color code and what is a theme ?

Answers

Answer:

Color coding and theme

Explanation:

Color coding is changing a certain thing to a color, like a subject, so math would be blue in my textbook, or planner. Theme in literary definition is the meaning in a story.

Answer: Color code is when certian things are a specific color. Theme is the subject or topic.  

Explanation: You use color code to mark things like in a hospital red means fire. Or if you are color coding your notes, one section could be blue and a different scetion could be pink. In stories, the theme is a lesson learned. Theme could also be like in a party the theme could be basekball or princess.

Quick!!!!! Will mark Brainliest!!!!!
What are 3 reasons the Articles of confederation proved to be to weak to guide the nation?

Answers

Answer:

Each state only had one vote in Congress, regardless of size.

Congress did not have the power to tax.

Congress did not have the power to regulate foreign and interstate commerce.

Explanation:

i think

PLEASE HELP QUICK
Which statements about enslaved persons in the North Carolina colony are correct? Check all that apply.

They typically were enslaved by Quakers in the backcountry.
They came with other immigrating groups to work on large plantations.
They worked long hours.
They were unable to marry legally.
They often did not have enough food or clothing.

Answers

Hey is the one ☝️ was a great I wanna

In the myth of Isis and Osiris, Set killed Osiris and scattered pieces of Osiris all over Egypt. Isis and her sister, Nepthys, gathered the pieces. What was the next event in the myth?

Answers

I'm pretty sure its C. Isis brought Osiris back to life

Why did Stephen Austin travel to Mexico City in 1822? to
A ask Mexican authorities to release his father from prison
B to campaign for a seat in Mexico's new legislature
C to convince the Mexican government to approve his colonization plan
D to join the fight for Mexican independence from Spain​

Answers

Answer:

C

to convince the Mexican government to approve his colonization plan

Answer:

C. to convince the Mexican government to approve his colonization plan

Explanation:

How did calligraphy affect ancient China? ANSWER NOW!!!

Calligraphy enhanced communication and influenced printing.
Calligraphy showed that writing did not have to be artistic.
Calligraphy influenced ancient China by replacing painting.
Calligraphy emphasized that writing was not important in ancient China.

Answers

Answer: Calligraphy enhanced communication and influenced printing.

Explanation:

Calligraphy offers an important channel for the appreciation of traditional culture and for arts education. It is also a source of pride and pleasure for the Chinese people and embodies important aspects of the country's intellectual and artistic heritage.

It enhanced communication and influenced printing

explain different types of agents of socialization​

Answers

Answer:

[tex] \bold{ \boxed{ \text{See \: below}}}[/tex]

Explanation:

[tex] \underline{ \text{Introduction \: to \: Socialization}} : [/tex]

The process of learning the culture , tradition , norms and values to adapt to the society is called socialization. In other words , socialization is the prcess of the transformation of the culture , tradition , social values and norms on to the children by their parents , teachers and other members of the society so as to help them grow up as good and responsible member of the society.

[tex] \underline{ \text{Agents \: of \: Socialization}} : [/tex]

There are different means of socialization. Such means of socialization are called the agents of socialization. The agents of socialization are mainly grouped as primary and secondary agents.

[tex] \bigstar{ \: \: \underline{ \text{Primary \: agents \: of \: socialization}}} : [/tex]

➳ The agents which are the first contact in the process of socialization are called primary agents. Such agents help individuals to be socialized in informal ways. The most immediate factors of socialization such as family , friends , neighbourhood , relatives , festivals , fairs , rituals etc. are known as the primary agents. Socialization process is spontaneous and happens without much conscious efforts.

Individuals learn the process of socialization from the environment created by the family and friends and such environment created by them is the primary agent of socialization.

[tex] \bigstar{ \underline{ \text{ \: Secondary \: agents \: of \: socialization}}} : [/tex]

➳ Secondary agents of socialization refer to the formal ways of teaching and learning etiquette , culture , norms and values. Formally set environments such as schools , educational institutions , social - political organizations or institutions , clubs and people such as teacher , medias and various formal programmed organized in the society are the secondary agents of socialization.

Thus , socialization is a process of becoming a member of a society by learning it's set culture , tradition , norms and values through various agents. Socialization is very important and integral in the life of an individual since s/he cannot live an isolated life , away from the society.

[tex] \text{Hope \: I \: helped!}[/tex]

[tex] \text{Best \: regards!}[/tex]

~[tex] \text{TheAnimeGirl}[/tex]

4. Explain how a person can be free of illness but not be well. Provide an example. 5. Explain how a person can have a disability and still be well. Provide an example.​

Answers

Answer:

Having a disability does not mean a person is not healthy or that he or she cannot be healthy. Being healthy means the same thing for all of us—getting and staying well so we can lead full, active lives. That means having the tools and information to make healthy choices and knowing how to prevent illness.

Explanation:

What did settlers want that indians had?

Answers

Answer:

They wanted the government to move the Native Americans to the Plains so the whites could settle in the Southeast for farming.

Explanation:

Who? jamestown or plymouth

Which is the best way for a small interest group with little money to influence congressional representatives to support their stance on an issue?

showing representatives how the group’s stance on the issue fits with their party’s philosophy
providing representatives on appropriate committees with detailed information about the issue
promising support for the reelection of influential representatives in return for support on the issue
developing long-term relationships with representatives who would have the most interest in the issue

Answers

Answer:

Selective benefits

Explanation:

I had a similar question to this on my lesson, I got this answer, I hope it helps, let me know if it didn't. Have a nice day

Which component of weather describes the weight of the atmosphere pressing down on Earth?

Answers

Answer:

Air pressure is the weight of the atmosphere pressing down on the earth. It is measured by a barometer in units called millibars. Most barometers use mercury in a glass column, like a thermometer, to measure the change in air pressure.

Explanation:

pls mark me as a brainlliest

Answer: pressure is the weight of the atmosphere pressing down on the earth. It is measured by a barometer in units called millibars. Most barometers use mercury in a glass column, like a thermometer, to measure the change in air pressure.

Explanation:

Article II of the Constitution defines the roles of

the president and the vice president.
the president and the legislative branch.
the vice president and the legislative branch.
the vice president and the judicial branc

Answers

Answer:

A) The president and the Vice President.

Answer:

A: The president and the vice president

Explanation:

According to the Constitution

Other Questions
A primary care physician is a doctor who treats many types of illness and injuries. A specialist is a medical professional who has chosen to focus on one field of medicine, such as an oncologist, who treats only cancer, or a podiatrist, who focuses only on treating foot conditions. What are the advantages of seeing a specialist as opposed to a primary care physician? List at least one circumstance in which you might want to see a specialist, and at least one circumstance in which you might want to see a primary care physician. About 238,000 results (1.16 seconds) "as" (and any subsequent words) was ignored because we limit queries to 32 words. What is the difference between 9 and -2?711-7-11 Write the ratio in simplest form.12:18please help meeee ! !!HELP!! A coral reef, like the one shown in the photo, is a structure composed of the calcium carbonate exoskeletons of corals, a type of animal. Which term best characterizes the role of corals in a coral reef ecosystem? On the periodic table, why are all noble gases placed in column 18 (8A)?A.Noble gas elements have identical molar masses.B.Noble gases are all rarer than elements in other columns.C.The noble gases only chemically react with other noble gases.D.The valence electron configuration is similar in all noble gas elements. The model represents an equation.What value of x makes the equation true? HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid.