The Mesozoic would last how many days

Answers

Answer 1

Answer:

it lasted for 186 million years.

Explanation:

from 252.902 to 66 million years ago


Related Questions

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

Which of the following cells would be found in connective tissue?


Osteocytes


Goblet cells


Mucous cells


Neuroglial cells

Answers

Explanation:

the common cell types in connective tissue include: fibroblasts, mast cells, plasma cells, macrophages, adipocytes, and leukocytes. Slide 72 Tendon. Fibroblasts are the most common cell type of connective tissue. They produce both fibers and amorphous ground substance.

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.

Answers

i believe it is true
If haves to be true

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

If all grasshoppers are removed from the food chain, what will happen to the blue birds

Answers

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

Answer:

If all grasshoppers are removed from the food chain...the bluebirds will decrease in numbers.

Explanation:

I hope that this has helped you to understand your question. If you have any further questions, please put them below.

Have a great rest of your day/night!

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.
Other Questions
Select a hypothesis above that would help restore equilibrium and explain your reasoning. Question 15 (1 point)A teacher has a bag of marbles. There are 10 red, 10 blue, 8 green, 8 purple, and 8yellow marbles in the bag. As the students enter the classroom, they draw a marbleand keep it. If the first student in the room draws a yellow, and the second draws ablue, what is the probability that the third student will draw a green?19%O 21%15%17%Previous PageNext PagePage 15 of 16 The two strands of the DNA are antiparallel to each other such that at the end of the DNA one strand will be 3' paired with a 5' end. a. Trueb. False Please help gotta pass dis Alex and Nick collect baseball cards. Alex has three more than twice as many cards as Nick. Together they have 27 cards. How many cards does Alex have? A. 8B. 12C. 17D. 19 Find the perimeter of a quadrilateral with vertices at C (-2, 1), D. (2, 4), E (5,0), and. F (1, -3)12 unitsO 16 unitsO 20 unitsO 24 units why did the olympic structures in brazil crumble A trapezoid has an area of 156.45 square miles. One base is 7 miles long. The height measures 14.9 miles. What is the length of the other base what did George Rogers clark target in order to weaken british support sytems HELP PlS !!What caused the formation of the Eastern Bloc ? or Why was the Eastern Bloc formed ? Why did Adam's foreign policy cause a split in the federalist party Pls answer correctly thanks ! :) Think about the novel or short story you read for Module Five. What does the resolution tell you about the future of the protagonist? Cite quotations and page numbers from your novel or short story that support your ideas. THE STORY IS MAGICAL NEPHEW HELP ME ASAP PLEASE ILL MARK BRAINIEST PLEASE HELP MEEEEEE 2) What is the volume of a basketball that has a diameter of 15 inches? what is the mean of 3 6 11 7 4 anybody else just been super emotional throughout this whole pandemic thing? For the trapezoid below, what is the correct term for RT?RE11TLwA. LegB. ApothemC. BaseD. AltitudeHELPPP MEEE ASAPPPPP PLSSSS Which integer is the most negative -3, -4, -5, -11, -12, -14 Priya makes bracelets for her online store. Her monthly business expenses are $520. She sells an average of 80 bracelets permonth. Based on the inequality below, if she wants to profit at least $1,240, how much should she charge, b, per bracelet?80b - $520 > $1,240A. Priya needs to charge at most $19 per bracelet.B. Priya needs to charge at least $22 per bracelet.C. Priya needs to charge at most $22 per braceletD. Priya needs to charge at most $29 per bracelet. Tell me about a time you felt like you or something you did was noticed and appreciated by someone at school. Who was it and what happened?please answer