The Mesozoic Era was the Age of Dinosaurs, and the current Cenozoic Era is the Age of​

Answers

Answer 1

Answer:

Mammals

Explanation:

It had the the largest land animals that have been mammals during that time


Related Questions

Which of these does not represent a direct transfer of carbon

1.Air to trees
2.Giraffe to tree
3.Tree to Giraffe

Answers

The answer is tree to giraffe. Trees need carbon to make oxygen. Giraffes give off carbon when they exhale.

The genetic composition of an organism is called the

Answers

Answer:

The genetic composition of an organism is called the genotype.

Why aren't human hunters a threat to polar bears anymore?

Answers

because the biggest threat to them is climate change!

Its because the Governments of the Arctic States are now regulating such people by  creating laws, restrictions and quotas to polar bear hunting. Some of those are:

-Amount of Polar bears that can be hunted

-Restriction to hunting certain age or gender

-Native people only being allowed to hunt them (excluding Canada) etc

Even capturing has quotas too. Those are:

-Who takes the polar bear

-Amount of Polar bears that can be taken

-The Life they will have while in captivity

Why is it important that the seedling’s true leaves grow quickly?HURRY IM BEING TIMED

to help disperse seeds to areas where they can grow
to shield the seedling from too much water or rain
to protect the seedling from receiving too much sunlight
to make food for the seedling’s continued growth

Answers

Answer:

The correct answer is - to make food for the seedling’s continued growth.

Explanation:

The true leaves that emerge from the seedlings are the leaves that are capable of performing photosynthesis and start generating food and energy. These support the plant for the rest of its life in terms of food and energy.

Seedlings grow from the soil, two leaves in beginning called cotyledons that are not the true leaves and not able to perform photosynthesis and generate their food for the seedling’s continued growth.

What are ways that biodiversity loss can be reduced?
Select all that apply.
keeping seeds in seed banks
controlling invasive species
captive breeding
fragmenting habitats

Help FINAL EXAM please

Answers

I think the second one

100 points (50 each) How do workers decide when to set a controlled burn, and how do they know if they have been successful?

Answers

Answer:

It is very important to have the latest and most updated weather conditions available before starting the burn. Relative humidity is an important factor to consider when planning a controlled burn. If the relative humidity is below 50%, the dryness of the grass is prone to causing very hot fires

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called . When a population is severely reduced by an environmental disaster such as a fire, the result is a due to the reduced genetic diversity of the survivors. 3. The can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Answers

Answer:

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called Genetic drift.

When a population is severely reduced by an environmental disaster such as a fire, the result is a Bottleneck effect due to the reduced genetic diversity of the survivors.

The Founder effect can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Explanation:

Genetic drift is an evolutive force. It is the random change that occurs in the allelic frequency of a population through generations. Its effects are harder in a small-sized population, meaning that the magnitude of this change is inversely related to the size of the original population.  

Genetic drift results in some alleles loss -including the beneficial ones-, while some other alleles get fixated. Low-frequency alleles are the most likely to be lost. The changes produced by genetic drift accumulate in time and results in a loss of genetic variability within a population.  

Genetic drift affects a population and reduces its size dramatically due to a disaster or pressure -bottleneck effect- or because of a population split -founder effect-. The bottleneck effect most likely affects smaller populations.  

The bottleneck effect -a case of genetic drift-, mostly affects smaller populations after the occurrence of a natural disaster or some human action -such as extensive hunting, for instance-. These events might act as a pressure that reduces significantly the number of individuals in a population. In these situations, some alleles are lost, and the survivors have a different genetic charge than the one of the original population. There might be a reduced genetic variability, with a possibility of developing a peculiar allelic component. If the survivors in the population carried or developed a mutation, probably this mutation passed from generation to generation.  

Founder effect refers to the origin of a new population from only a few individuals that are coming from a bigger-sized population. These founder individuals, which are carrying some of the genes of the original population, settle down in a new area and reproduce.  The new and small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be lost by complete. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced, and there exists the possibility of developing a peculiar allelic composition. When the number of individuals that originated the new population is low, the founder effect will be very extreme because the genetic drift effects are inversely proportional to the original number of individuals.

Hello! Offering 25 points. I need it urgently.

Answers

The somatic nervous system transmits sensory and motor signals to and from the central nervous system. The autonomic nervous system controls the function of our organs and glands, and can be divided into the sympathetic and parasympathetic divisions.

,

In holly trees, Red fruit (R) are dominant to white fruit (r), and spiny leaves (L) are dominant to smooth leaves (l). Complete the dihybrid Punnett Square to figure out how many of the new holly trees from this cross would be excpected to have white fruit and smooth leaves??


A. 1


B. 2


C. 3


D. 9

Answers

Answer:

All answers are in the image

What types of change can mutations have?

Answers

Answer:

Explanation:

Base Substitutions. Single base substitutions are called point mutations, recall the point mutation Glu -----> Val which causes sickle-cell disease.

Answer:

Types of Mutations

Missense mutation: This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by ...

Nonsense mutation: A nonsense mutation is also a change in one DNA base pair. ...

Insertion or Deletion: An insertion changes the number of DNA bases in a gene by adding a piece of DNA.

Explanation:

rashid is conducting a seminar on the importance of coral reefs which point should he include

Answers

Answer:

Protect coastlines from storms, erosion and provide habitat.

Explanation:

Coral reefs protect coastlines from storms and erosion as well as provide a habitat for thousands of aquatic animals. These points rashid must include in his seminar. Coral reefs are very important for the marine ecosystem because it can save the soil from erosion and decreases the intensity of storms by acting just like barrier. It provides food as well as living place for many organisms so these point are very important to be included in the seminar.

Answer:

that corals provide economic assistance to coastal populations through fisheries

Explanation:

I've been looking around for the answer in this interactive website that was included within to answer these questions but, I couldn't find it and I'm wasting time looking for it.

Answers

Answer:

Iron is what mercury is mostly made of

Which of the following is not a concern about nuclear energy?

Answers

Nuclear energy produces less carbon than fossil fuels

FREE BRANLIEST IF YOU ANSWER A foul ball can be caught by the defensive team for an out.

Answers

Answer:

TRUE!! IT CAN

Organisms can pass on their genetic information through asexual reproduction. Asexual reproduction is a form of reproduction that involves ______ parent.

Answers

Answer:

1

Explanation:

the prefix A- means one

‼️‼️‼️
PLEASE HELP WILL GIVE BRIANLIEST :))

Answers

Answer:

J SHAPED CURVE GIRL

Explanation:

HOPE THAT HELPS MUAH!

“When graphed, it appears as a J-shaped curve”, and “it occurs under ideal conditions with unlimited resources”

Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1–2 sentences.(2 points)

Answers

Answer:

It could help them understand what ancestors they came from and what species they are most related to.

Explanation:

How did the findings from Hershey and Chase’s bacteriophage experiments likely influence the Meselson-Stahl experiment, and how might Meselson and Stahl’s results help scientists understand how damaged DNA can be inherited by future generations?

Answers

Answer:

c, just took the test

Explanation:

Why can't polar bears survive on berries or eggs?

Answers

Answer:

Polar bears that are forced to live on land due to melting ice face lean times in most of the Arctic. Food found on land, such as berries and eggs, lack the high fat content and calories of the bears' preferred prey.

Explanation:

because they aren’t land animals and depend on fish

Question 5 of 10
As of the year 2000, the human population was approximately

Answers

Answer:

A. 6 billion

Explanation:

The full question is:

As of the year 2000, the human population was approximately _______.

A. 6 billionB. 3 billionC. 1 billionD. 10 billion

If air pollution causes the rain that falls on this pond to become much more acidic after two years how will this acidity
affect the living things in this pond?
There will be more plants and animals because the acid will kill most of the disease causing microorganisms
There will be more plants and animals because the acid is a source of food,
There will be fewer plants and animals because many of them cannot survive in water with high acidity,
D There will fewer plants and animals because the acid will dissolve many of them,

Answers

Answer:

the guy above me is correct

Explanation:

I know this isn't a explanation so I don't really know why I am putting it under the explanation category but I am really sorry if it is wrong

Food chains and food webs show how producers, consumers, an decomposers are connected to
one another as chemical energy flows through different
in an ecosystem
a. energy pyramids
b. trophic levels
c.biospheres
d. abiotic components
HELP WILL MARK BRAINLIST

Answers

Answer:

The correct answer is Choice B.

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

Food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem.

A food web is a complex diagram that exhibits all of the food chains in a given ecosystem.

A food chain is a diagram that represents the transference of matter and energy (as food) from different trophic levels.

A trophic level is defined as a group of organisms in the ecosystem found at the same level in the food chain.

Producer organisms (e.g., plants and algae) are organisms that synthesize their own food.

Consumers (e.g., herbivores and carnivores) are organisms that need to eat organisms from a different population to survive.

Decomposers (eg. bacteria and fungi) are organisms that carry out the process of decomposition by eating dead plants and animals.

In conclusion, food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem (Option B is correct).

Learn more in:

https://brainly.com/question/13267087?referrer=searchResults

why large spaces present between
spongy mesophyll cells​

Answers

These large spaces allow these layers to help carbon dioxide move around the leaf. The spongy mesophyll also allows the plant to bend and move in the wind, which itself helps move gases around the leaf's cells.

Como se chama a transferencia de enrgia termica flui de um corpo com maior temperatura quando ao outro de menor temperatura quando ha diferença de temperatura entre ambos

Answers

Answer:

Conduction.

Explanation:

Conduction is the process in which heat energy is transferred from the hotter body towards colder body because of temperature difference between two bodies. Conduction occurs only due to physical contact between two bodies. In the conduction process, the thermal energy flows from a body with a higher temperature to the other body having lower temperature until both bodies having same temperature.


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

what are the 3 ways a species can become isolated and form new species? define what each of them mean.

Answers

Answer:

behavioral isolation, geographic isolation, and temporal isolation


Can you please help me with this...

Answers

Answer:

A. Asexual

Explanation:

I majored in Biology

Does light have an effect on carbon dioxide production by plants and animals?

(No Links!! type the answer)

Answers

answer:

Light provides the energy for photosynthetic pig- ments to convert carbon dioxide (CO2) and water into sugars and oxygen. As light intensity increases – until a point – the amount of sugars increases and thus, more energy is available for plant growth and maintenance. hope this helps :D

Please help me with this!!

1. Which process plays a part in genetic recombination? A. Asexual reproduction. B. Cytokines. C. Independent assortment. D. Mitotic division.

2. Which correctly lists the following terms in order from smallest to largest? DNA, chromatin, chromosomes, nucleosomes.
A. Chromatin, DNA, Chromatin, nucleosomes
B. Chromosomes,DNA, Chromatin, nucleosomes
C.DNA, nucleosomes, chromatin, chromosomes
D. Nucleosomes, DNA, chromatin, chromosomes

3. In a triploid organism, how many alleles are present for each gene per cell?
A. 1
B. 3
C. 6
D. 9

Answers

I) Independent assortment.

II) Nucleosomes, DNA, chromatin, chromosomes.

III) 3.

EXPLANATION:

Recombination scrambles pieces of maternal and paternal genes, which ensures that genes assort independently from one another.

➻ We know that Chromatin is a complex of DNA and proteins that forms chromosomes. Chromatin looks like beads on a string. The beads are called nucleosomes. Each nucleosome is composed of DNA.

Triploids with three different alleles can easily be detected because they have a unique phenotype.

The process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene.

In independent assortment, different gene variants or 'alleles' are independently and randomly assorted into daughter cells, which allows genetic recombination.

In eukaryotic organisms, DNA is associated with histone proteins in order to form nucleosomes, which arrange in higher organization structures called chromatin fibers.

Subsequently, chromatin fibers condense to form structures called chromosomes.

A triploid organism (3n) contains three sets of homo-logous chromosomes, each one containing one allele for a given locus.

In conclusion, the process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene per cell.

Learn more in:

https://brainly.com/question/10118000

How does air pollution affect the ecosystem?

Answers

Answer:  

The deposition of acidifying air pollutants causes acidification of surface waters (lakes, rivers and streams) and forest soils, leading to loss of nutrients such as potassium and magnesium from soils and the release of toxic aluminium into soils and waters, resulting in adverse effects on animals and plants.

Explanation:      

Other Questions
Why did the population of Eastern Europe decline following World War II? Will mark brainlist and please show your work! ) What is the area of triangle QBA? Enter only the number to represent the area below. plz i need the answer Which of the following is closest to the length A: 7.2 units B: 8 units C: 10.8 units D: 11.7 units Can anyone help me please? 6. If the pressure of a gas is 1.01 atm and the temperature is 25C, then if the pressure is increased to 1.10, what is the new temperature? Based on the description of the prison, what conclusion can we draw about the way women are treated while in custody? What does the paradox of the tom-tom imply aboutjazz musicJazz is not respected by white listeners. Jazz's smile contains pain and joy.Jazz brings suffering to those who smile 2. (a) Solid calcium oxide was taken in a container and water was added slowly to it:(i) Write the observation.PLS ANSWERR Kristen has $13.50 in quarters and dimes. She has a total of 75 coins. How many dimes does Kristen have?A. 30 dimes B. 45 dimes C. 35dimes D. 40 dimes I NEED HELP ASAP!!!!!! i need helpp :D cuz if i dont get all my missing bellringers in i wont get to go to a concerttttt The relationship between bacteria and legumes that results in nitrogen is best described as _______.a.parasiticb.mutualisticc.commensalisticd.none of the above Please help! I am so confused. Use the pronoun EN to avoid repetition in this sentence: Abby achte des vtements. You are working on your conclusion, but you're having trouble challenging your readers. Which of the following strategies will help you with that? A.)Capture your key points and comment on their significanceB.) Use the words "From these examples, we can see that..."C.) Walk away from your writing to describe your ideas to a friendO Show your readers what will happen if they change their thinking Study the map of Palestine in 1947. A map of Palestine in 1947. Jerusalem is labeled. A key notes the Arab state, Jewish state, and Jerusalem (U N). Jerusalem is neutral and surrounded by the Arab state. Parts of the Jewish state surround the Arab state and are close to Syria and Trans-Jordan. Which statement describes how the Arab population responded to this map? They wanted access to the Mediterranean Sea. They felt it represented an equal distribution of land. They opposed the division of land into two separate states. They demanded the United Nations take control of the entire region. The length of each base of a trapezoid is shrunk to one-third its original length and the height of the trapezoid is tripled.Lisa claims that the area of the new trapezoid is one-third the area of the original trapezoid.Which expression best uses the dimensions of the new trapezoid to compare its area to the area of the original trapezoid in order todetermine if Lisa's claim is accurate?Alh + b) 3hC 3(02+)31D please help!!!!!!!!! Frank was in a horrible car accident. He was paralyzed from the waste down. Which body system was injured to cause the paralysis?1. Respiratory system2. Integumentary system3. Nervous system The table below shows the short-run production function for Camila's Convenience Store.Number of ClerksTotal Product per Hour15213323435550662772876After which clerk do diminishing marginal returns begin for Camila's Convenience Store?Explain using numbers.