The map shows the locations of major earthquakes in the Northern Hemisphere.
North
America
Pacific
Ocean
Atlantic
Ocean
Which sentence describes the pattern of earthquakes that the map shows?

Answers

Answer 1

Answer:

earthquakes around the North American continent


Related Questions

could someone help me with this please

Answers

Answer:

3

Explanation:

4 and it almost looks like a motorcycle Engine part if you look at it close

The coronavirus attaches to a membrane protein called

Answers

Answer:

M glycoprotein..

The coronavirus attaches to a membrane protein called M glycoprotein..

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

What can we say about the
kinetic energy of the particles
in this object?
A. It has very low energy
B. It has medium energy
.
C. It has very high energy

Answers

C

Energy will gather together

Hey My Name is Chloe, and I need some Help, But if you can't it's ok,

So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine

Answers

Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.

Explanation:

Answer: Animal: Bengal tigers

Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world?  Are bengal tigers being bred in captivity.

Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.

Explanation: I would suggest looking at national geographic if you want cooler animals.

Question 1/7 The Nile River carries sediments to the ocean. Over time, the sediments are compressed as more sediments are deposited on top of them. Which type of rock will be formed?​

Answers

Answer:

Sedimentary Rock

Explanation:

Sedimentary rocks are formed from pieces of sediments or other existing organic matter or rock.

The sedimentary rock formation process begins with weathering which involves the breakdown of the sediments into small fragments. The next process is erosion, where water like the Nile River carries them to other places -  in this case, the Ocean.

Over time, the sediments settle and become compressed as more sediments are deposited on top of them.

This leads to the formation of Sedimentary Rocks.

What is the definition for polyploidy?

Answers

containing more than two homologous sets of chromosomes.

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell

Answers

Answer:

This question lacks options, the complete question is: What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell, or a harmful mutation in an adult multipotent stem cell?The correct answer is a harmful mutation in a pluripotent embryonic stem cell.

Explanation:

Pluripotent Stem Cells can self-renew and differentiate into any of the three germ layers, which are: the ectoderm, the endoderm and the mesoderm. These three germ layers subsequently differentiate to form all the tissues and organs within a human being. If during embryonic development, genetic mutations - alterations in genes - occur in the embryonic stem cell, they pass to daughter cells as a consequence of cell division, and an individual is generated whose cells differ at the genetic level. Multipotent stem cells are organospecific cells, that is, they can give rise to any type of cells but from a specific organ (a lung, a kidney or the brain). Their differentiation ends the moment they specialize and become a cell with a specific function within a specific tissue or organ. If there were a mutation in these cells, it would damage a specific designed tissue or organ.

I neeed helppppppp

Chemical Weathering 5 facts about it

Answers

Answer:

5 Facts

Explanation:

1. When it comes to chemical weathering, it’s all about chemistry. By looking at the term “chemical weathering,” you can see that a chemical reaction causes something to break down or “weather.” That “something” is rocks and minerals.

2. In chemical weathering, rocks and minerals are reacting to acids, oxygen, carbon and water. That’s why no two rocks ever look exactly the same. It’s also the reason that we have those awesome looking caves and unique rock formations all over the world.

3. While chemical weathering creates nifty formations, the way it breaks down rocks also causes fractures in ancient structures like the Great Sphinx of Egypt. It also causes the surface to break down on gravestones.

4. Chemical weathering types can work separately, but they often work together to create landforms and break down minerals.

5.  Acid rain caused by pollution such as factory and car exhaust is another agent of chemical weathering.

how do you understand geological hazards?​

Answers

Answer:

Geologic Hazards

Seismic hazards related to earthquakes, including ground rupture/faulting, liquefaction, strong motion, and tsunami.Landslides of all kinds, including seismically-triggered landslides, debris flows, mud flows, and rock falls.Mineral hazards such as asbestos, radon, and mercury.

Explanation:

hope it helps you

please mark me as brainlist

Each of the following is a density-dependent limiting factor EXCEPT:

- crowding
- predation
- competition
- disease

Answers

Answer:

predation

Explanation:

predation

I hop this answer is correct

Answer:

Disease

Explanation:

Describe the type of plate movement that is occurring where subduction zone volcanoes are found.

Answers

Answer:

Convergent boundary

Explanation:

It's when the plates move together and subduction occurs when one plate moves underneath another on a convergent boundary. Volcanoes are found there.

P.S. Brainliest, please?

How do antibiotics work? Note: you will not be given credit for simply stating “they prevent bacterial growth” or “they kill bacteria”

Answers

Antibiotics stop infections caused by bacteria, they kill it , and/or keep them from copying themselves or reproducing . antibiotic means against life, so any drugs in your body is technically an antibiotic. they attack the wall or coating surrounding the bacteria

Answer:

here's your answer

Explanation:

May this helps you..

examples of green house gases​

Answers

Answer:

Carbon dioxide

Methane

Nitrous Oxide

Explanation:

What are the two resulting cells formed from single cell called

Answers

"Daughter cells" is the correct answerThe cell that splits is called the "parent cell" and the two cells that form are called the "daughter cells".Please let me know if I am wrong.

how are yarns made up of?​

Answers

Answer:

Yarn is a strand composed of fibres, filaments (individual fibres of extreme length),... Yarns are made from both natural and synthetic fibre, in filament or staple form. Filament is fibre of great length, including the natural fibre silk and the synthetic fibres.

Answer:

cotton you can get cotton from sheep

What do coal deposits tell you about the continents?

Answers

Answer:

Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.

seasons work help needed please

Answers

Answer:

July

Explanation:

it is typically the warmest month of the year globally because the Northern hemisphere has more land masses than the southern hemisphere

A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).

Answers

Answer:

The allelic frequency for pointed ears is 0.5 (50%).

Explanation:

The frequency of alleles in a population must add up to 1 (100%).

The allelic frequency for pointed ears is 0.5 (50%).

What is allelic frequency ?

The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.

What is the difference between gene frequency and allele frequency?

Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.

To learn more about allelic frequency , here

https://brainly.com/question/23362399?referrer=searchResults

#SPJ2

If a gene has two alleles, there are two possible genotypes.

a. True

b. False

Answers

Answer:

b. False

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.

According to Mendel's Law of Dominance, if a gene has two alleles, there are three (3) possible genotypes.

The three (3) possible genotypes are;

I. A combination of alleles such as AA.

II. A dominant combination (phenotype) such as Aa.

III. A recessive combination such as aa.

Where;

A represents the dominant allelea represents the recessive allele.

Also, a single version of a gene expressed by a living organism is referred to as an allele.

PLEASE HELP QUICKLY

Match each of the following to the correct organ system.

Lungs

Heart

Veins

Arteries

Stomach

Large intestine

Trachea

Small intestine

Muscles

Bones

Liver

Pancreas

Gall bladder

Kidney

Bladder

Choices are...


A. Skeletal System

B. Excretory System

C. Digestive System

D. Circulatory System

E. Muscular System

F. Respiratory System

Answers

Explanation:

1. stomach - Digestive

2. Brain - Nervous

3. Heart - Cardiovascular

4. kidneys - excretory

5. bone marrow - lymph

6. pituitary gland - endocrine

7. xylem- vascular tissue

8. bones - skeletal

9. Fallopian tubes - reproductive

hope this helps liine some up together i dont give whole answers just try to help ppl out, ill see what i can do thogh, dont quite undderstand can thee be more than one to go with the numbered ones?

What is the purpose of cellular respiration. In a short sentence

Answers

Answer:

Produce energy (in the form of ATP) for metabolic processes and muscle contraction.

Explanation:

Which of the following are prokaryotic cells?

A) plants

B) fungi

C) bacteria

D) animals

E) B and C only

Answers

fungi, bacteria

If I remember right, eukaryotic means there's more than one, so I believe this answer is right

The Answer is c: bacteria

please help ::( i wanna pass w good grades

Answers

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

Try to move the different parts of the body
by moving it back and forth, side to side,
rotating, and swinging.​

Answers

The given question is incomplete, however, the missing part is as follows:

body parts movement

neck _____

lower arm _______

upper arm ________

wrist __________

shoulder _________

skull _________

knee _________

hipbone _________

elbow _________

ankle _________​

Answer:

The correct answer is given as follows:

Explanation:

A. side to side

B. swinging

C. rotating

D. rotating

E. rotating

F. back and forth

G. swinging

H. side to side

I. back and forth

J. rotating

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

At the zoo, Anya observes that individuals of a certain kangaroo species have slightly different sizes and colors. What characteristic of populations is Anya observing?

O adaptation
O evolution
O selection
O variation

Answers

The answer is variation, because the same species can vary in color and sizes

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

Match each term to the appropriate description.

Answers

Answer:

Have a great day!

Explanation:

The appropriate term for each description would be ecosystem, community, population, organism, and species respectively.

Definition of ecological terms?

An ecosystem is a community of all living organisms interacting with their environment as a system.

A community is a collection of different populations of organisms.

A population is a group of organisms of the same species capable of mating.

Species are a group of organisms that is capable of breeding to produce fertile offspring.

Thus, the term for each description would be ecosystem, community, population, organism, and species respectively.

More on ecological terms can be found here: https://brainly.com/question/13046612

#SPJ2

Other Questions
Find the equation of a line parallel to y = x 3 that contains the point (-2, 1).Yeah What was something Bruno enjoyed doing in Berlin that he starts doing atOut-With? *playing the pianowriting poetryexploringplaying games with Gretel Write a review of the poem Immortality Ode. PLEASE ANSWER THIS I WILL GIVE YOU BRAINLEST!!!!!! -What is a covenant? (a)- A sacred law. (b)- a movement of goods (c)- a solemn agreement (d)- a long journey. D: Which playwright has only seven surviving plays, and many people consider his Oedipus Rex the greatest Greek tragedy?AeschylusSophoclesEuripidesAristophanes Plzzz help. Will give branliest.Why should experiments be replicable? A. So that the materials used can be validated.B. So that scientists can gain popularity in the community.C. So that fewer errors will be made and the data appear to be more correct.D. So that others can repeat experiment and obtain similar results. What is the momentum of a car with a mass of 1,300 kg traveling north at a speed of 28 m/s? (01.04 MC)Graph with x axis labeled Quantity Demanded and numbered in hundreds, 100 to 500. Y axis is Price, with prices 0 to 6. A line representing the Demand Curve starts at 100, 5 and drops at an angle down to 500, 1. Dashed lines extend from the x and y axes to point A 10, 15. Solid lines extend upward from the x axis to the green line at points 100, 5, 200, 4, 300, 3, 400, 2, and 500, 1. Public DomainBased on the graph, what would happen if customers demanded 550 units of this product? The price would drop to 0.5. The quantity would be 0. The quantity would be 0.5. The price would rise to 2. As you read this passage, think about how to describe its tone.New research identifies cracks over the moon's crust that may have been created by the cooling and shrinking over the past billion or so years. Scientists have discovered landforms littered across the moon's surface called lobate scarps that have apparently resulted from the moon's shrinking very slowly. These scarps were found all over the moon and appear to be minimally weathered, indicating that the geologic events that created them were fairly recent. This theory contradicts the claim that the moon is completely devoid of geologic activity.What word best describes the tone of the passage?simplepersonalcasualformal The coronavirus attaches to a membrane protein called olve for x: 3(x + 1) = 2(x 1) + 6. What was true about the Russian Revolution?A. It caused a fear of foreign influence in the United States.B. It resulted in a world financial crisis.C. It caused a decrease in immigration to the United States.D. It restored a monarchy. An iron block of 12 kg undergoes a process during which there is a heat gain from the block at 2 kJ/kg, an elevation increase of 32 m, and a decrease in velocity from 40 m/s to 7 m/s. During the process, which also involves work transfer, the internal energy of the block increases by 70 kJ. Suppose the total energy of the system remains constant. Determine the work transfer during the process in kJ and indicate whether the work is done on/by the system. #BLABLABLA BLABAMOOOOOINKKKBAAAAAAAAAHheadahh Getting paid to do something you love doesn't feel like work Find the area of parallelogram with base b and height hb=82.cmh=16.6cm How important are social relationships in early childhood? find the interest rate you are borrowing $2,500 for 2 years and you ear $450 in interest * Esponja: unscramble the following sentences to find out about Cristians week. 5mins 1. Tiene/el martes/ de futbol/partido. 2. En bicicleta/ monta/ el mircoles/ con unas compaeras. 3. El jueves/ con una amiga/ de compras/ va/ a la librera. 4. Un examen de ingles/ el viernes/ tiene 5. Hace/ el sbado/ para/ la maleta/ ir de viaje.6. De la pelcula/ compra/ nuevo/ el DVD/ el domingo/ de Cameron Diaz. mircoles/ jueves * Esponja: indica el complemento directo. 1. Mis padres hacen la maleta. 2. Elisa ve pelculas en DVD. 3. Mis amigas y yo compramos ropa en la tienda de moda. 4. Miras fotos en tu tableta? 5. Tu y juan escuchan canciones en el reproductor de mp3. 6. Mi hermano pepe toca el piano. 7. Llamamos a nuestros abuelos los fines de semanas. Viernes Esponja: usa el complemento del objeto directo para contestar las preguntas. 5mins. 1. Ves la pizarra? 2. Ves el pupitre? 3. Ves las revistas? 4. Ves la computadora? 5. Ves los libros de espaol? 6. Ves el reloj? escribe oraciones utilizando las si guientes palabras como el ncleo del sujeto # compaeros#flores