The main purpose of the ______ system is to distribute blood throughout the body.
A. musculoskeletal
B. circulatory
C. digestive
D. respiratory

Answers

Answer 1

Answer:

B. circulatory

Explanation:

Answer 2

Answer: B

Explanation: The circulatory system delivers oxygen and nutrients to cells and takes away wastes. The heart pumps oxygenated and deoxygenated blood on different sides. The types of blood vessels include arteries, capillaries and veins.


Related Questions

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

If all grasshoppers are removed from the food chain, what will happen to the blue birds

Answers

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

Answer:

If all grasshoppers are removed from the food chain...the bluebirds will decrease in numbers.

Explanation:

I hope that this has helped you to understand your question. If you have any further questions, please put them below.

Have a great rest of your day/night!

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.

Answers

i believe it is true
If haves to be true

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

Atoms from sugar molecules may combine with other elements via chemical reactions to form other large carbon-based molecules

Answers

Answer:

Yes.

Explanation:

Yes, carbon atoms from sugar molecules combine with other elements through chemical reactions to form other large carbon-based molecules. Sugar molecules comprise of carbon, hydrogen, and oxygen atoms. The hydrocarbon of sugar molecules are used to make amino acids and other carbon-based molecules that can be combine into larger molecules such as DNA molecule.

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

Which of the following cells would be found in connective tissue?


Osteocytes


Goblet cells


Mucous cells


Neuroglial cells

Answers

Explanation:

the common cell types in connective tissue include: fibroblasts, mast cells, plasma cells, macrophages, adipocytes, and leukocytes. Slide 72 Tendon. Fibroblasts are the most common cell type of connective tissue. They produce both fibers and amorphous ground substance.

a food web is shown below. Which of the following organisms compete for the mouse as a food source?

Answers

Answer:

it should be the snake bc I have one and the mouse gets eat in by the snake

According to the food web in the diagram, the hawk and the snake are the organisms competing for the mouse as a food source.

FOOD WEB:

A food web is a interaction of many food chains. It shows the feeding pattern of different levels of organisms.

Ideally, producers are fed on by primary consumers, followed by secondary consumers, then tertiary consumers.

In the food web attached to this image, two arrows connects hawks and snakes to the mouse. This means that hawks and snakes are potential predators or consumers of mouse.

Therefore, the hawk and the snake are the organisms competing for the mouse as a food source.

Learn more about food web: https://brainly.com/question/20472214?referrer=searchResults

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

What element would we not be able to shower without?

Answers

I believe in the idea of that and my answer of identity is on the math

Drag each label to the correct location.
Identify the types of clouds shown in the image.
altocumulus
Cirrus
stratus
high
clouds
middle clouds
low clouds
middle
clouds

Answers

Answer:

The high clouds are cirrus,

The middle clouds are cumulus,

And the low clouds is stratus.

Explanation:

High clouds are cirrus, middle clouds are cumulus, and the low clouds are stratus.

What are the different types of clouds?

There are several types of clouds, classified based on their height, shape, and composition. Here are the main types of clouds:

Cirrus clouds: Thin, wispy clouds high up in the atmosphere, composed of ice crystals.Cumulus clouds: Puffy, white clouds that can resemble cotton balls. Stratus clouds: Low-level clouds that form a uniform, gray layer in the sky. Alto clouds: Middle-level clouds that are composed of water droplets and sometimes ice crystals. Cumulonimbus clouds: Towering clouds that can reach high into the atmosphere, often associated with thunderstorms, heavy rain, hail, and lightning.Stratocumulus clouds: Low-level clouds that are often arranged in rows or patches, resembling scales or fish scales.Nimbus clouds: These are dark, gray clouds that are associated with rain or snowfall.

Thus, the high clouds in the image are cirrus, the middle clouds are cumulus, and the low clouds are stratus.

Learn more about clouds, here:

https://brainly.com/question/1558130

#SPJ5

What is the greenhouse effect?


A
Greenhouse gases trap in oxygen and warm Earth.

B
Greenhouse gases trap infrared radiation and warm Earth.

C
Greenhouse gases trap UV radiation and cool the Earth.

D
Greenhouse gases trap carbon dioxide so plants can grow.

Answers

Answer:

B.

Explanation:

due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.

Trade winds blow from the horse latitudes toward the______.
equator
the tropics
the poles

Answers

Answer:

the correct answer is the equator

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

What is climate change? O A. Lange-scale changes to weather patterns B. Increasing temperatures only C. Natural cycles of cooling and heating D. Decreasing temperatures only ​

Answers

Answer:

C. Natural cycles of cooling and heating is the best option.

Explanation:

C. is the only answer that describes climate, the others describe weather. Climate is natural conditions over a long period of time while weather is over a short period of time.

Please give brainliest.

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries
Other Questions
You cannot use Carbon dating to find the age of something if it is... A. Too OldB. Too YoungC. Not made of CarbonD. All of the Above Suppose that LM = 36. Use the Triangle Proportionality Theorem to find PM. Round to the nearest tenth A group of scientists want to observe the adaptation of a foreign fish species in a river ecosystem. To do this, they want to enclose the top and sides of a section of a river to block light and matter from entering the area. Evaluate whether this experimental system is an isolated system. Justify your answer based on the definition of an isolated system. No links please and please help determine the surface area of a right circular cone that has a slant height of 5.8 ft and a diameter of 6.4 ft? round your answer to the nearest whole. I recipe requires 1/2 cup of flour to make 9 cupcakes using this recipe how much flour is needed to make 12 cupcakes Please help with this (number 10 btw) I will Mark Brainliest if you answer all questions How did the Union army gain control of the Mississippi River?O A. By capturing RichmondB. By capturing GettysburgC. By capturing AtlantaD. By capturing VicksburgHELP PLZZ ASAP!!!! A room is 15 feet tall. An architect wants to include a window that is 6 feet tall. The distance between the floor and the bottom of the window is b feet. The distance between the ceiling and the top of the window is a feet. This relationship can be described by the equationa=15(b+6)a=15(b+6).The customer wants the window to have 5 feet of space above it. Is the customer describing a or b? What is the value of the other variable? Write the equation in point-slope form of the line that passes through the given point and has the given slope: (-2, -1); m=-3 Solve the inequality J+7>3j-4 write an end of school year letter to yourself, and think about goals for the upcoming school year. why did lena act strangly A cable is 60 meters long. How long is the cable in decimeters?Be sure to include the correct unit in your answer. In the 1930s, many people lost their homes to foreclosure. That meant the homes wereDestroyed by vandalsTaken back by the lender because owners couldn't make payments.Destroyed by weatherBurned to the ground by angry mobs. 2(x + 1),x = 5Substitute Help- pleaseThe school that Scott goes to is selling tickets to a play. On the first day of ticket sales the school sold 9 adult tickets and 4 student tickets for a total of $177. The school took in $73 on the second day by selling 1 adult ticket and 4 student tickets. Find the price of an adult ticket and the price of a student ticket.Price of an adult ticket $Price of a child's ticket $ A clock draws 2.0 watts of power to operate and is in operation 8,600 hours per year. The energy usage of the clock, in kWh per year, is closest to Four stage in which abortion cannot be done.