temperature is the degree of_ or_ of a substance​

Answers

Answer 1

Answer:

Temperature is the degree of hot or cold of a substance

Explanation:

Because temperature can be hot or cold

I hope it help you


Related Questions

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

PLS HELP ILL MARK BRAILIEST
Spend one minute writing an explanation of
the FUNCTION of enzymes. YOU MUST USE
THE WORDS CATALYST, ACTIVATION
ENERGY, RECYCLABLE

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions. Activation energy is the energy needed to start a chemical reaction. This is illustrated in Figure below. The biochemical reaction shown in the figure requires about three times as much activation energy without the enzyme as it does with the enzyme.

The reaction represented by this graph is a combustion reaction involving the reactants glucose (C6H12O6) and oxygen (O2). The products of the reaction are carbon dioxide (CO2) and water (H2O). Energy is also released during the reaction. The enzyme speeds up the reaction by lowering the activation energy needed for the reaction to start. Compare the activation energy with and without the enzyme

Answer:

Enzymes help speed up chemical reactions in the human body. They bind to molecules and alter them in specific ways. They are essential for respiration, digesting food, muscle and nerve function, among thousands of other roles.

What is the function of an enzyme? They allow chemical reactions to occur at normal body temperature fast enough to sustain life. They reduce the activation energy needed to start a chemical reaction.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

Enzymes create chemical reactions in the body. They actually speed up the rate of a chemical reaction to help support life. The enzymes in your body help to perform very important tasks. These include building muscle, destroying toxins, and breaking down food particles during digestion.

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

4.Paramecium is able to move by hairlike structures called
____

Answers

Answer:

Cilia

Explanation:

           

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

In three to five sentences, construct an argument that shows why lichens are necessary to establish a new ecosystem after an extreme disturbance.
I would really appreciate it if someone o two people would help me out on this one

Answers

Answer:  Lichens affect every species in the ecosystem, in 2013 Russia had a dramatic lichen die off which caused 61,000, 20% of the entire reindeer population to die from starvation. And with fewer deers, the bears and wolves also suffered from the loss of lichens and if it takes a long time for lichens to grow back in an ecosystem, animal declines may take years if ever to be corrected.  Lichens serve as a basis for several food chains, especially in artic communities.

The argument which shows why lichens are necessary to establish a new ecosystem is as follows;

Lichens are known to enable algae to live all over the world in many different climates.

On this note, lichens also provide a means to convert carbon dioxide in the atmosphere through photosynthesis into oxygen, a process required by all to survive.

Additionally, lichens provide us with valuable information about the environment around us.

On this basis, lichens are important for establishing a new ecosystem after an extreme disturbance.

Read more on lichens and the ecosystem;

https://brainly.com/question/1504278

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

The farmer realizes he could sell mini-dragons as pets, but doesn't want them to breathe fire, because that would be dangerous. Suggest two parental genotypes for parents that would produce mini, non-fire breathing dragons.

Answers

Answer:

ddff  and DDFf

Explanation:

From the information given:

Let DD represents the dwarf traits and FF represents the ability for the dragons to breathe fire.

Also, if dd represents the normal traits and ff represents the inability of the dragons to breathe fire.

Then; we can cross a dominant trait for dwarfism which has a heterozygous trait for fire with a recessive trait of normal and nonfire.

The two parental gametes are: ddff  and DDFf

Using a Punnet Square:

         DF              Df

df      DdFf           Ddff

df      DdFf           Ddff

From above; we could observe that the proportion of progenitors that will be dwarf and at the same time unable to breathe fire is 50%.

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

There is the picture to the question

Answers

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

Answer fast please. !!!!!!!!!!!!!!!!!!A geologist who needs to curricula to rock formations in different areas can match exposed rock layers
true or false

Answers

Answer:

A geologist who needed to correlate two rock formations in different areas could match exposed rock layers? A geologist who needed to correlate two rock formations in different areas could match exposed rock layers. TRUE.Explanation:

Answer:

true

Explanation:

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect does this mutation have on the individual? WILL GIVE BRAINLIEST
The individual suffers from sickle cell anemia.

The individual suffers from myotonic dystrophy.

The individual suffers from Fragile X syndrome.

The individual suffers no negative effects.

Answers

i believe it to be the first one

Answer:

The individual suffers from sickle cell anemia.

Explanation:

Deformed red blood cells occur in 1 in 500 African Americans. This is caused due to a gene mutation called point mutation that alters the structure of the red blood cell. This alteration affects the cell's ability to carry oxygen.

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

Other Questions
Marcia is at a store with a 20% off sale. She also has a coupon for an additional 10% off the sale price.Prove or disprove the following statement: A 20% discount on the original price of an item, followed by the use of a 10% off coupon, results in a total discount of 30%. A metal ion (X) with a charge of 4+ is attracted to non metal ion (Z) with a charge of 3-. Which of these formulas represents the resulting compound pls answer asap options in photo pregn de serviciokjjj Superior Micro Products uses the weighted-average method in its process costing system. Data for the Assembly Department for May appear below: Materials Labor Overhead Work in process, May 1 $22,300 $35,694 $173,247 Cost added during May $135,305 $23,796 $115,498 Equivalent units of production 1,900 1,800 1,700Required:a. Compute the cost per equivalent unit for materials, for labor, and for overhead. (Round your answers to 2 decimal places.)b. Compute the total cost per equivalent whole unit. So this set3 a + 7 + 2 a &7 a + 5 Is not equivalent But how to you tell if one is equivalent or not?ACTUALLY ANSWER IT AND NOT SAY SOMETHING JUST TO GET POINTS PLEASE xD Read this excerpt from The Golem.RABBI LOWThe emperor will need more convincing than I can provide. But there must be another way to save our people. That's what I'm looking for in these books.PEARLIn your books!?!RABBI LOWThese books contain holy truth. The secrets of the true world, not this world of illusion. There are prophecies, prayers, charms. One of them will reveal a way to protect our people. I know it.PEARLHow do you know it?Rabbi Low buries his head in his hands.He lifts his head and looks at Pearl.RABBI LOWBecause it must.What do Rabbi Lows lines and actions best show about him?He is unsure about how to save his people.He believes deeply in the wisdom of his books.He is deeply frustrated with the emperor.He is deeply troubled by his wife Pearl. Factor the expression using the GCF100 - 80 = ??? you ride through some wet paint on your bike creating a red spot on the tire. write a cosine equation to model the height of the red spot over the distance you ride. Your bike tire has a radius (r) of 11 inches. The period is the circumference of the tire (2pir)start the cycle when the spot is at the top of the tire witch is better gacha life or gacha club or anime or animal crossing Why was the new Indian school system a problem for Indians? When warm air rises at theequator, how does cooler airmove? Every month, Jay pays $53.42 for his internet bill. How much did he pay for internet over the past 5 months?First CORRECT answer gets Brainliest! (I'm too lazy to do 5th grade math sorry!) Can anyone explain the Ethos Pathos and Logos in these ads? A random sample of 663 teens who said they did not typically eat fast food reported an average daily calorie intake of 2258, with standard deviation 1519. A random sample of 413 teens who said they did typically eat fast food reported an average daily calorie intake of 2637, with standard deviation 1138. The two populations are moderately positively skewed. Based on the above description, which of the following conditions are met for conducting a hypothesis test for the equality of two means?a. Both samples are randomb. Samples are independent of one anotherc. Both samples are normal enough given the sample sized. Two population means need to be the same Assume that 41.1g of hydrogen peroxide decompose to produce oxygen gas at STP to the following balanced equation:2H2O2 (l) ---------> 2H2O(l) + O2 (g)How many Liters of oxygen gas are produced? What is the correct coefficient for 2H2 + O2 2H2O Math Teacher is giving extra credit to who ever can come up with the best theme for his kids birthday party!!!Has to be a movie!You can chooseA. Hunger GamesB. Men in BlackC. Classic Horror MoviesD. Jurassic ParkOR!!Awnser With your own suggestion!!!!!!! X-y=36x-7y=11what is the answer to this HELP plz solve all 5 questions for 62 points if they are correct you will be marked brainiest PLEASE HELP I"M BEING TIMED OFFERING 20 POINTS AND BRAINLIEST Which best explains the message the Monroe Doctrine sent to other nations? that the United States was powerful enough to stop new colonization in the Americas that the United States was afraid of each nation that sought to colonize the Americas that the United States wanted to take over other nations in Europe and in the Americas that the United States feared the power of European nations and would allow them to colonize the Americas