Suppose you travel to a tropical place like the Bahamas and watch the coastal poikilotherms, such as fish, crabs, and starfish, swim and crawl about in the warm waters. Suppose then that you travel to northern Maine and watch the related species of poikilotherms in the cold waters there. It would not be unreasonable to expect to see the animals in Maine moving about in slow motion compared to those in the Bahamas. In fact, however, rates of locomotion are likely to look to your eye to be more similar than different in the two places. Design experiments to assess whether the Maine animals are especially able to be active in cold waters. If you find that they are, how might their high ability for activity in cold waters be explained

Answers

Answer 1

Answer:

The correct answer is -

exposure of the opposite environments to the species and see if they are able to be active in cold waters.

If they are then species of organism in Maine and could have more ice-nucleating agents which are responsible for their high ability for activity in cold waters.

Explanation:

To test the assess if the Maine species of organisms are especially able to be active in cold waters an experiment can be designed where one needs to place the species or animals from Maine and Bahamas in reverse conditions.

Maine animals are placed in warm water environments and species from the Bahamas can be placed in cold water. Finding if they are able to adapt in reverse condition by calculating various processes and motion, if yes then  it shows that it is not a special ability to survive in cold temps. However, if it is not then the Maine poikilotherms are specially designed for their environment. In case of yes then species of organism in Maine and could have more ice-nucleating agents


Related Questions

1. Imagine you played the game, and the results are as follows. Examine the tables below and questions (a) and (b)
Sample Data for Stable Food Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 2 2
3 4 4 4
4 5 5 6
Sample Data for Stable Food Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 3 2 2
4 4 2 2
A) Describe what happens to the bird population for both the East and West sides of the Islands in terms of its composition of different size beaks when the food source is stable over several seasons.
B) Are the initial populations maintained, explain?
2. Imagine you played the game again, but under different conditions. Examine the tables below, and answers (a), (b), and (c).
Sample Data for Natural Selection Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 3 3
3 4 3 2
4 8 5 0
Sample Data for Natural Selection Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 2 2 2
4 2 0 3
A) What happened to the composition of the original population over these four seasons for the East and the West?
B) What factor(s) might have caused these changes?
C) How was natural selection acting on this population?

Answers

Answer:

The population is increase in the east due to good and wet environment.

Explanation:

The bird population of the East and west sides of the Islands is increases of different size beaks when the food source is stable over several seasons because the presence of food to all size of beaks leads to increase in their populations. The initial populations is increased in the east side as compared to west side may due to good environmental conditions. The population of east side increases as compared to west side due to good and favourable environmental condition of the east side of the island.

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

Which wire, when current flows through it, would be surrounded by the strongest magnetic field?

A thin copper colored bar.
A copper colored coil with 2 turns.
A copper colored coil with 5 turns.
A thick copper colored bar.
Mark this and return Save and Exit

Answers

Answer:

A copper with 5 turns

Explanation:

Answer:the other guy is right

Explanation:

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si


When can an acquired mutation be passed from parent to offspring

Answers

If the mutation takes place in a gamete that ends up forming an embryo, the mutation will be passed on to an offspring. This can also occur if the mutation occurs early in an embryos development, and the cell becomes one of the gamete forming cells, the mutation will be passed on to their offspring.

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:

Some cells release active signaling proteins when membrane-bound precursor proteins are cleaved by proteolytic enzymes. The signaling proteins can then bind to receptors on the surface of a target cell, thereby activating an intracellular signaling pathway and eliciting a response from the target cell. This mechanism of activating receptor-binding signaling proteins has been observed in a variety of organisms from bacteria to humans. Many of the enzymes responsible for proteolysis of membrane-bound precursor proteins have been isolated and characterized.


Required:

What questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species?

Answers

Answer:

Following questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species:

Are the genes encoding the proteolytic enzymes expressed in the same cell types in all species?  Once the precursor proteins of different species are cleaved, do the active signaling proteins bind to  the same receptors on different target cells? If a proteolytic enzyme from one species is incubated with a precursor protein from another species, does correct cleavage occur? Are the proteolytic enzymes synthesized in the rough endoplasmic reticulum of all species?

which statement is correct about the polarity of a water molecule

Answers

Answer:

Water is Polar

Explanation:

There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.

Water is polar good luck

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

One of the biggest sources of greenhouse gases released into the
atmosphere is emissions from burning fossil fuels. How could carbon
sequestration help alleviate problems associated with burning fossil fuels?
A. It could make fossil fuels a clean-burning energy resource.
B. It could prevent carbon dioxide from being a greenhouse gas.
O C. It could prevent released carbon dioxide from entering the
atmosphere.
D. It could make fossil fuels a renewable energy resource.

Answers

Answer:

The correct answer is - B. It could prevent carbon dioxide from being a greenhouse gas.

Explanation:

Carbon sequestration is the process that involves capturing and removal of atmospheric carbon dioxide from the atmosphere and prevent it from changing climate by increasing global warming as carbon dioxide gas traps the heat.

It is helping in the removal of excess carbon dioxide from the atmosphere and prevents it from being a greenhouse gas and increase global warming. It could be geological or biological.

Answer: C- it could prevent released carbon dioxide from entering the atmosphere

Explanation: ap3x

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

how did natural disasters affect animal populations?​

Answers

Answer:

When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need

Explanation:

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer
Other Questions
What was the economic impact of the Bell Bomber Plant, military bases, and Savannah and Brunswick shipyards on Georgia duringWWII?A)These industries put people to work to support the war effort and broughtthe state's economy back from the Great DepressionB)These industries caused the state to go into debt to provide materials tosupport the war effortThese industries were known for exploiting child labor and caused manychildren to drop out of school to work in the factoriesD)These industries were reliant on the labor of sharecroppers and tenantfarmers, which caused many landowners to go into debt On the main floor of the Kodak Hall at the Eastman Theater, the number of seats per row increases at a constant rate. Lucas counts 31 seats in row 3 and 37 seats in row 6. How many seats are there in row 20?67616365 Connecting a charged object to the ground creates a way for the charged object to leak that charge into the earth. This is called ? HELP making brainliest if it's correct and explain NO explaintion=no brainliest This is about pi and 25 is NOT the answer. If you choose 25, have a link, an answer that isn't even near the answer to the question (ex. "Hhhhjjhf thank you" isn't a real answer) you will be reported. Thank you guys need explanation for brainliest but is optional. Since one refraction cup is half of a cylinder, how could you change the formula for the volume of a cylinder to calculate the volume of a refraction cup? What is the difference between "highest injury claim rates" and "highestinjury claims"? Which one do you think is more important? Explain. Which of the following is the best definition of a land speculator? a. someone who settled in the West under the Homestead Act b. someone who abandoned a land claim before meeting the five-year requirement c. someone who took advantage of homesteading laws to make a profit, often illegally what most helped the North recover more quickly than the South from the Civil War? Which of the following statements correctly describes the evidence shown bythe structures in the accompanying image?*WhaleFrogPorceBirdVARROWO c. The human and the bat share analogous bone structures in their forelimbsb. Only the human and the frog share homologous bone structuresa. The bat and the frog share analogous bone structures in their forelimbsd. All the species shown share homologous structures in their forelimbsAll the species shown share analogousructures inforelimbsOThis is a required question explain melting and freezing using the kinetic theory of matter Look at this table:-41081-3102710-29-1103010Write a linear (y = mx + b), quadratic (y = ax?), or exponential (y = a(b)") function thatmodels the data.y = At City Burger, 4 of the last 8 customers wanted cheese on their burgers. What is the experimental probability that the next customer will want cheese on his or her burger?help fast please!!! Which person do you agree with the most?A Casey: The human population had been fairly constant throughoutEarth's history.Allayna: Population size is increasing at a significant rate due toadvances in technology, medicine, and sanitation. Karl: Population size has been decreasing over time because peopleare having fewer children. Dr. Miller conducts a study examining the relationship between the number of friends one has and the experience of daily stress and life satisfaction. Dr. Miller decides to create a scatterplot of the relationship between daily stress and life satisfaction, but in doing so, she realizes there are three scores that seem to be very extreme and are nowhere near the other points on the scatterplot. Specifically, it appears that three people report very high levels of daily stress and very low levels of life satisfaction. Dr. Miller should probably consider these scores _________. a 0.1 kg slinky sits at the top of a staircase with 14 J of potential energy. How high is the staircase? Clare is 5 years older than her cousin.How old would Clare be if her cousin is:10 years old?2 years old?[tex]x[/tex] years old?Clare is 12 years old. How old is Clares cousin?Diego has 3 times as many comic books as Han.How many comic books does Diego have if Han has:6 comic books? [tex]n[/tex]books?Diego has 27 comic books. How many comic books does Han have?Two fifths of the vegetables in Priyas garden are tomatoes.How many tomatoes are there if Priyas garden has:20 vegetables?[tex]x[/tex] vegetables?Priyas garden has 6 tomatoes. How many total vegetables are there?A school paid $31.25 for each calculator.If the school bought calculators, how much did they pay?The school spent $500 on calculators. How many did the school buy? Which value from the set ( 6,7,8,9) makes 3r +2= r + 92 true ? pls help ill give brainliest if correctpic is attached Dunn Sporting Goods sells athletic clothing and footwear to retail customers. Dunn's accountant indicates that the firm's operating cycle averages 6 months. At December 31, 2019, Dunn has the following assets and liabilities: 1. Prepaid rent in the amount of $8,500. Dunn's rent is $500 per month.2. A $9,700 account payable due in 45 days.3. Inventory in the amount of $46,230. Dunn expects to sell $38,000 of the inventory within 3 months. The remainder will be placed in storage until September 2020. The items placed in storage should be sold by November 2020.4. An investment in marketable securities in the amount of $1,900. Dunn expects to sell $700 of the marketable securities in 6 months. The remainder are not expected to be sold until 2022.5. Cash in the amount of $1,050.6. An equipment loan in the amount of $60,000 due in March 2024. Interest of $4,500 is due in March 2020 ($3,750 of the interest relates to 2019, with the remainder relating to the first 3 months of 2020).7. An account receivable from a local university in the amount of $2,850. The university has promised to pay the full amount in 3 months.8. Store equipment at a cost of $9,200. Accumulated depreciation has been recorded on the store equipment in the amount of $1,250.Required:Identify Current Assets and Liabilities.