Sunlight allows producers and the animals that depend on them to live in the ______ zone.
A.abyssal
B.neuritic
C.bathyal
D.intertidal

Answers

Answer 1
The answer is bathyal
Answer 2

Answer: B. Neuritic zone


Related Questions

Native vegetation determines the _________________________ and _________________________ of organic matter in the soil.

Answers

Answer:

Explanation:

Texture

Plant cells are different from animal cells. The diagram below identifies four different structures in a plant cell. Compared to the structures in an animal cell, which of the following structures is found only in a plant cell?

a. Mitochondrion
b. Cell Wall
c. Cytoplasm
d. Nucleus

Answers

B.cell wall , hope this helps
The cell wall is only found in a plant cell


Which term best describes the joints at the top of your
skull?

A.) Motionless
B.) Flexible
C.) Rubbery
D.) Elastic

Answers

Answer: A

Explanation:

the joints on the top of your skull is motionless

Examine the Punnett square below. A cross between the two parents results in 50 offspring. How many of the offspring are most likely to have the dominant trait?

Answers

From what I know a punnet square like that gives a 75 percent chance of the dominant trait to that offspring. I’m not entirely good at the subject but I hope that helps?
75 % ........................

1. In the diagram, the arrow #9 is pointing to an organelle called





mitochondria
nucleus
smooth endoplasmic recticulum
endoplasmic recticulum

Answers

Answer:

Mitochondria

Explanation:

Someone PLEASE HELP!!!

Answers

Answer:

Autosomal Recessive

Explanation:

The method of inheritance is autosomal recessive. Notice how the disease skips the parent generation. This indicates that parents have the recessive allele but do not express the trait. The individuals who are shaded in have two recessive alleles that were passed on from their parents, therefore they have the disorder.

Which of the following correctly describes how DNA contributes to the traits that appear in offspring? A) DNA contains the instructions for building RNA, which influences traits. B) DNA contains the instructions for building proteins, which create the physical traits of offspring. C) DNA contains the instructions for building carbohydrates, which are responsible for the physical traits of offspring. D) DNA contains the instructions for building enzymes, which catalyze chemical reactions for the traits of offspring.

Answers

a dna contains the instructions

DNA attributes to the genotype preference to the individual.  DNA contains the instructions for building RNA, which influences traits. The correct statement is answer A.

What is the full form of DNA ?

DNA stands for deoxyribonucleic acid.

DNA contains the orders that are needed for any organism in order  to develop, survive as well as reproduce. To carry out these duties, DNA sequences are needed to be converted into messages which can be used to produce proteins in  which are the complex molecules that are  doing  most of work in our body.

Since we have two pairs of chromosomes and we also have two pairs of genes in which  one  is from our father and one is  from mother. These pairs of genes then determine certain physical features or traits.

Learn more about DNA at :

https://brainly.com/question/264225

#SPJ2

I NEEEEEDDDD HELP PLEASE

Answers

Answer:

Proteins.

Explanation:

Genes contain instructions to  assemble amino acids in proteins.

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.

In rabbits, spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b). A true-breeding black spotted rabbit is mated to a true-breeding brown solid rabbit to produce a heterozygous F1 generation. Two F1 individuals are mated, and you do not see a 9:3:3:1 (black spotted: black solid: brown spotted: brown solid) ratio of offspring, but instead see that almost all offspring are a non-recombinant phenotype. This tells you that

Answers

Answer:

Epistasis effect result into these offspring

Explanation:

Given

spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b)

Genotype of true-breeding black spotted rabbit BBSS

Genotype of  true-breeding brown solid rabbit bbss

Genotype of offspring BbSs

In normal crossing between BbSs and BbSs offspring of F1, should produce offspring in the ratio 9:3:3:1

But it does not happens in this case the simple reason could be  presence of Epistasis in which the alleles assort independently but do not express themselves because of the following reasons -

a) Interaction between two or more loci thereby resulting into new phenotypes

b) An allele at one locus masks effects of other allele at one or more loci

c) Allele at one locus modifies the effects of alleles at one or more other loci

What are some physical properties of the sun?

Answers

Answer:

Mass: 1.98892 x 1030 kg.

Diameter: 1,391,000 kilometers.

Radius: 695,500 km.

Surface gravity of the Sun: 27.94 g.

Volume of the Sun: 1.412 x 1018 km3

Density of the Sun: 1.622 x 105 kg/m3

Explanation:

in dogs, being clumsy (C) is dominant to being cool (c) and being dazzling (D) is dominant to being docile (d)

Answers

Answer:

i didnt know that..!

Explanation:

Answer:

9/16

Explanation:

CcxCc = CC, Cc, Cc, cc (3/4)

DdxDd = DD, Dd, Dd, dd (3/4)

3/4 x 3/4 = 9/16

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

What are some things you think would help identify a fossil? *

Answers

Answer: by studying the Fossil record we can tell how long life has existed on earth,and how different plants and animals are related to each other.often we can work out how and where they lived, and use this information to find out about ancient environments fossils can tell us about a lot about the past.

Explanation: If you like it please mark brainlest....

Why don't individuals with Tay-Sachs pass on the Tay-Sachs
allele?
a
Tay-Sachs disease is a recessive human genetic
disorder.
b Carriers are not affected.
c Affected individuals do not have children.

Answers

Answer:

Affected individuals do not have children.

Explanation:

Those individuals that are better able to survive in the Environment tend to be:

Answers

Answer:

Fit

Explanation:

They are the ones who are strong enough to survive.

Sound waves move the slowest through which medium? water ice air wood

Answers

Answer: The answer is the following.

the question is: sound waves move through which medium?

a. water

b. ice

c. air

d. wood

the best answer to this question would be c. air. <3

Explanation:

The Speed of Sound: Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids. Air is a gas so therefore, C. AIR IS THE CORRECT ANSWER :)

The sound waves move the slowest through which medium:

C.Air

The sound waves move the slowest through which medium is air. Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids.

Therefore, the correct option is C.

Know more :

https://brainly.com/question/14405871?referrer=searchResults

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

can you please answer these questions for me I really need help I am begging you

Answers

Answer:

1: 75%

2: 75%

3: 50%

4: 25%

How does type 1 diabetes affect the cardiovascular system?

Answers

Answer:

diabetes can damage your blood vessels and the nerves that control your heart and blood vessels, causing to have a bad affect on your cardiovascular system.

. A _____________________________________________ key is used to determine the identity of an organism

Answers

Answer: A dichotomous key is a tool that allows the user to determine the identity of items and organisms in the natural world. It is the most widely used form of classification in the biological sciences because it offers the user a quick and easy way of identifying unknown organisms.

Explanation:

Our atmosphere is composed of several gases. The name of the gas we breathe, O2, is A) oxygen squared B) monoxide. C) oxide. D) diatomic oxygen.

Answers

A. Oxygen Is the most abundant

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

How are animals in the polar dying connected to climate change?
help

Answers

Answer: well, ce dependent species such as narwhals, polar bears, and walruses are at increasing risk with shrinking sea ice cover. ... As the Arctic loses snow and ice, bare rock and water absorb more and more of the sun's energy, making it even warmer. This is called the albedo effect.

Explanation:

PLEASE HELP


The theory of plate tectonics is supported by evidence that crustal plates move relative to each other. How does this observation support the theory of plate tectonics?
It suggests that plates are dragged around by ocean currents.
It suggests that plates are dragged around by air currents.
It suggests that plates can move independently of one another.
It suggests that plates cannot move independently of one another.

Answers

Answer:

Its c the third answer

Explanation:

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer:

Ok here ya go

Explanation:

The lytic cycle is one of the two cycles of viral reproduction, the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane. Now during the lytic cycle of virulent phage, the bacteriophage takes over the cell, reproduces new phages, and destroys the cell. T-even phage is a good example of a well-characterized class of virulent phages.

is this answer good enough? That’s all I know to my knowledge

What is true about one strand of DNA?


It contains many chromosomes.


It contains many proteins.


It contains many pieces of RNA.


It contains many genes.

Answers

Answer:

it contains many genes.

Answer:

D: It contains many genes

what was explained by darwins theory of biological evolution

Answers

Answer:

When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.

Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.

Explanation:

What was explained by it? Evolution. But how did it explain evolution? That is in the answer.

Write short note on consumer.

Answers

Answer:

i don't know ajisjdbehanjakdiodjebfbnakoy

okkkkkkkkkkkkkkkkkkkkkkkkkkkk
Other Questions
convert 1 1/2 years into month? What type of plate boundary is shown in the diagram A. Subduction boundary B. Convergent boundary C. Divergent boundary D. Transform boundary What is the volume...no links as the answer. Please help asap this is urgent. What does S.P.Q.R. mean? ASAP LIKE RIGHT NOW PLEASEExplain what happens to the amplitude of a wave when the energy to produce it is increased. in easy words The fastest pizza box folder can assemble 8 pizza boxes in 21 seconds. At this rate, how long would it take to assemble 20 pizza boxes? What is the diameter of the circle? Be careful here... its asking for diameter!!!64m8m16m Fill in the blank with the best possible word provided.The only way I am going to shrink my ____ is by saving more money each month.A. revenueB. leviesC. expendituresD. deficit Please help :( Ive been on this fit awhile A gaming PC valued at $2500 depreciates at a rate of 12.5% per year.Write a function that models the value of the computer over time.Find the value of the PC after 3 year. A 4.00g sample of helium has a volume of 24.4L at a temperature of 25.0 C and a pressure of 1.00 atm. The volume of the helium is reduced to 10.4L, but the temperature and pressure of the gas are kept constant. What is the new quantity of the gas in moles 1.2At which ages should a child be vaccinated with the pneumococcalconjugated vaccine? Pat is narrating a story in ASL. How can he indicate that the story has come to an end? You have been doing a class project on crime. Your teacher hasasked you to write an essay about the following statement: Any student caught stealing at school should be immediatelyand permanently excluded.You should state whether you agree or disagree with the statement.Write your essay. What things were like before Malcolm X accomplishment? Emily and her friends pick 27 lb of blueberries each pound of blueberries contains 195 blueberries how much blueberries been Emily and her friends pic Please help me I need help NO LINKS LINKS =REPORT PLEASEPLEASEPLEASEHas nothing to do with the top one I just cant editTHANK YOU FOR THE PEOPLE WHO HELP Using the sources and your knowledge of U.S. history, explain two different ways in which the United States contributed to the success of the Allies in the European Theater during World War II. Can any1 please copy and paste a section of a Midsummer's Night Dream that has 10 lines with 2 people talking? please i need help Watch help videoHannah is deciding between two truck rental companies. Company A charges aninitial fee of $30 for the rental plus $2 per mile driven. Company B charges an initialfee of $100 for the rental plus $1 per mile driven. Let A represent the amountCompany A would charge if Hannah drives miles, and let B represent the amountCompany B would charge if Hannah drives s miles. Write an equation for eachsituation, in terms of , and determine the interval of miles driven, I, for whichCompany A is cheaper than Company B.