State and explain the three basic properties of element​

Answers

Answer 1

Answer: Some are solid, some are gaseous, a few are liquid. Some are metallic: they have a peculiar lustre; some are coloured (like sulfur) or colourless. Some have a low density; some have a high density. Some are malleable and ductile; some are brittle. Some conduct electricity and heat well; some don’t.

Many metals tend to have structural uses. Nonmetallic elements less so.

Metals tend to have crystal forms featuring close-packed centro-symmetrical structures. Nonmetallic elements tend to have crystal structures featuring more open and directionally packed structures.

Some are especially toxic; some are essential to life; some are both depending on exposure level.

Most are stable; some are less so.

Some elements are highly reactive; some are almost inert (helium, neon, and argon may be completely inert in ambient conditions).

Many metals have basic oxides; quite a few oxides of nonmetallic elements form acids when they are dissolved in water. Some elements can go both ways.

There are many generalisations you can make about metallic and nonmetallic elements, and quite a few exceptions at the margins.

Explanation:

Answer 2

Given :-

State and explain the three basic properties of element.

Answer :-

Some properties of an element can be observed only in a collection of atoms or molecules of the element. These properties include color, density, melting point, boiling point, and thermal and electrical conductivity.

[tex] \\ [/tex]

Answered by - ItzMaster


Related Questions

The results of photosynthesis as glucose and oxygen
A) Photosynthesis
B)Products
C)Chloroplasts
D)Glucose

Answers

Answer:

Products

Explanation:

What number represents a mole?
5
1
4
14
8
6
19

Answers

6 is Avogadro’s number for one mole

WILL OFFER BRAINLIEST IF YOU CAN ANSWER THIS

Scenario 1: The pitcher throws a fastball down the middle of the plate. The batter takes
a mighty swing and totally misses the ball. The umpire yells, "Strike one!"
Scenario 2: The pitcher throws an off-speed pitch and the batter checks his swing. The
batter just barely makes contact with the ball and it dribbles down in front of the batter's
feet into foul territory. The umpire yells, "Foul ball; strike two!"

Scenario 3: The pitcher throws a curve ball that looks like it might catch the outside
corner of the plate. The batter swings with all his strength, but the bat grazes the
underside of the ball and the ball skews off to the right, flying into the crowd. The umpire
yells, "Foul ball, still two strikes!"

Scenario 4: The pitcher throws another fastball down the middle of the plate. The batter
swings and wallops the ball high into the air and the ball clears the center field wall that
reads 410 feet. The ump yells, "Homerun!"
In which scenario did a chemical reaction occur between reactant A and B?



Question 1 options:

1


2(INCORRECT)


3 (INCORRECT)


4

Answers

Answer:

I believe it is scenario 4

Explanation:

Materials that do not allow electrons to flow easily are called _____________.

Answers

Answer:

Materials that do not let current flow easily are called insulators.

Most nonmetal materials such as plastic, wood and rubber are insulators

For the reaction represented by the equation:

Cl2 + 2KBr → Br2 + 2KCl

how many grams of KCl can be produced from 356 grams KBr?

Answers

Answer:

223 g KCl

General Formulas and Concepts:

Atomic Structure

Reading a Periodic TableMoles

Stoichiometry

Using Dimensional AnalysisAnalyzing reactions RxN

Explanation:

Step 1: Define

[RxN - Balanced] Cl₂ + 2KBr → Br₂ + 2KCl

[Given] 356 gg KBr

[Solve] g KCl

Step 2: Identify Conversions

[RxN] 2 mol KBr → 2 mol KCl

[PT] Molar Mass of K - 39.10 g/mol

[PT] Molar Mass of Br - 79.90 g/mol

[PT] Molar Mass of Cl - 35.45 g/mol

Molar Mass of KBr - 39.10 + 79.90 = 119 g/mol

Molar Mass of KCl - 39.10 + 35.45 = 74.55 g/mol

Step 3: Stoichiometry

[DA] Set up conversion:                                                                                   [tex]\displaystyle 356 \ g \ KBr(\frac{1 \ mol \ KBr}{119 \ g \ KBr})(\frac{2 \ mol \ KCl}{2 \ mol \ KBr})(\frac{74.55 \ g \ KCl}{1 \ mol \ KCl})[/tex][DA] Divide/Multiply [Cancel out units]:                                                           [tex]\displaystyle 223.024 \ g \ KCl[/tex]

Step 4: Check

Follow sig fig rules and round. We are given 3 sig figs.

223.024 g KCl ≈ 223 g KCl

Which property is NOT used to separate a mixture?

Answers

Answer:

Conductivity.

Explanation:

C + 2ZnO → CO2 + 2zn
How many grams of
carbon dioxide will be
produced if 135 grams
of ZnO is completely
reacted?

Answers

Answer:

36.5 g CO2

Explanation:

First, Write a Balanced Equation  

C   + 2 ZnO → CO2  + 2 Zn

Useful Information,  

MW of ZnO = 81.41 g

MW of CO2 = 44.01 g

135 g ZnO x (1 mol ZnO /  81.41 g ZnO) x (1 mol CO2/2 mol ZnO) x ( 44.01 g CO2 / 1 mol CO2 ) = 36.5 g CO2

Which of the following creates greenhouse gases during the generation of electricity?

Answers

Answer:

carbon dioxide makes up the variety of greenhouse gas emission from the sector but smaller amount of methane nitrous oxide are also emmited and all these gases are released during the combustion of fossil fuels, such as coal,oil and natural gas, to produce electricity

Is the kool-aid man the jar or the liquid?
I know that this is for school but like i need to know

Answers

Answer:

I think both

Explanation:

transpiration is the process by which ____.

Answers

Answer:

Plants add water to the atmosphere

Explanation:

A Is the answer for this question

Type the correct answer in each box.

Balance the equation.

_____SiO2 + ______CaC2 → _____Si + _______CaO + _____CO2

Answers

The balanced equation of the given reaction is as follows: 5SiO2 + 2CaC2 → 5Si + 2CaO + 4CO2.

How is an equation balanced?

A chemical equation is said to be balanced when the number of atoms of each element on both sides of the equation is the same.

According to this question, a chemical reaction between quartz and calcium chloride is given to produce silicon, calcium oxide and carbon dioxide.

The balanced equation that represents an equal number of atoms on both sides is as follows:

5SiO2 + 2CaC2 → 5Si + 2CaO + 4CO2

Learn more about balanced equation at: https://brainly.com/question/7181548

#SPJ1

Larissa is making sautéed purple cabbage. First, she washes and cuts the cabbage into long thin strands. Then, she puts a
pan on the stove and adds butter. She allows the butter to melt and turn to liquid. Next, she adds the cabbage to the butter
sprinkles some salt on it, and stirs it. Larissa watches as the cabbage sizzles, releases steam, and softens. To finish the side
dish, she adds a squeeze of lemon juice to it, which causes it to change from purple to pink. Finally, Larissa empties the
cabbage into a bowl and puts it on the dinner table.
Which of the events involves a chemical reaction?
O Larissa adds butter to a pan and allows it to melt and turn to liquid.
O Larissa adds a squeeze of lemon juice to the cabbage, and it turns pink.
O Larissa watches as the cabbage sizzles, releases steam, and softens.
O Larissa washes and cuts some purple cabbage into long thin strands.
O Larissa empties the cabbage into a bowl and puts it on the dinner table.
O Larissa adds the cabbage to the butter with a sprinkle of salt and stirs it.

Answers

Answer:

When she adds lemon juice

Explanation:

I believe that it is when she adds lemon juice. Lemon juice is an acid, which causes a chemical reaction. It turns from purple to pink because of the acid. Lmk if it's right but I'm 99.9% percent certain it is correct.

Which of the following is an example of a population having variations?

Some worms are nocturnal and some a diurnal

All polar bears have coats

Ostriches run fast

The rabbits that eat grass will survive

Answers

Answer:

Some worms are nocturnal and some a diurnal

Explanation:

Variation is difference between cells, individual organisms, or groups of organisms of any species caused either by genetic differences (genotypic variation) or by the effect of environmental factors on the expression of the genetic potentials (phenotypic variation).

NOTE:these are of the same species.

10 points! Will mark brainliest!!

Answers

truefalsetruefalsefalsefalsetruefalsefalsefalse

How does sunlight affect seasons?

Answers

Answer:

Seasons are caused by the Earth’s revolution around the Sun, as well as the tilt of the Earth on its axis. The hemisphere receiving the most direct sunlight experiences spring and summer, while the other experiences autumn and winter. During the warmer months, the Sun is higher in the sky, stays above the horizon for longer, and its rays are more direct.

Please answer the question for BRAINLIEST

Answers

Answer:

The Drip, The Gucci, The Swag, and The OG

Explanation:

Drag and drop the labels provided into the boxes below to explain how the Earth-Sun-Moon system results in these seasons on Earth.

Answers

in order: tilted, rotates, revolving.

Determine what product will be produced at the negative
electrode for the following reaction:
2CuSO4 (aq) + 2H20 (1) -> 2Cu(s) + 2H2SO4(l) + O2(g)

A. CuSO4
B. Cu
C. H2SO4
D. H2

Answers

Cu will be produced at the negative electrode for the following reaction:

2CuSO4 (a q) + 2H20 (1) -> 2Cu(s) + 2H2SO4(l) + O2(g) ,therefore option (b) is correct.

What do you mean by the term electrolysis ?

Electrolysis is defined as a process of decomposing ionic compounds into their elements by passing a direct electric current through the compound in a molten  form.

Characteristics of negative electrode -:


The negative electrode in an electrolytic cell, is the one toward which positively charged particles are attracted.

The cathode has a negative charge because it is connected to the negatively charged .

When an electrolyte is dissolved in water and an electric current is passed through it, the Cations move towards the cathode and Anions move towards anode .

Cu will be produced at the negative electrode for the following reaction:

2CuSO4 (a q) + 2H20 (1) -> 2Cu(s) + 2H2SO4(l) + O2(g) ,hence option (b) is correct.

Learn more about negative electrode ,here:

https://brainly.com/question/20350113

#SPJ5


The  H2  product will be produced at the negative electrode for the following reaction 2CuSO₄ (aq) + 2H₂0 (1) -> 2Cu(s) + 2H₂SO₄(l) + O₂(g). option D is correct.

What is electrodes?

The electrode is an electrical conductor or source of electricity that carries electric current or circuit to the non-metallic circuit parts of a circuit, some examples are electrolyte and semiconductor.

The following reaction 2CuSO₄ (aq) + 2H₂0 (1) -> 2Cu(s) + 2H₂SO₄(l) + O2(g) is a redox reaction in which the negative end is producing the H2 gas and copper gets solidify  at the positive end.

Therefore, H₂  product will be produced at the negative electrode for the following reaction 2CuSO₄ (aq) + 2H₂0 (1) -> 2Cu(s) + 2H₂SO₄(l) + O₂(g). option D is correct.

Learn more about electrodes, here;

https://brainly.com/question/13098144

#SPJ2

PLEASE HELP
The theory of plate tectonics is supported by evidence that crustal plates move relative to each other. How does this observation support the theory of plate tectonics?
It suggests that plates are dragged around by ocean currents.
It suggests that plates are dragged around by air currents.
It suggests that plates can move independently of one another.
It suggests that plates cannot move independently of one another.

Answers

Answer:

non independantly

Explanation:

When 28242 J are transferred to water sample, its temperature increases 18⁰C to 63⁰C. Determine the mass of the water sample.

Answers

Answer:

149.79

Explanation:

Formula

Joules = m * c * delta (t)

Givens

J = 28242

m = ?

c = 4.19

Δt = 63 - 18 = 45

Solution

28242 = m * 4.19 * 45

28242 = m * 188.55

m = 28242 / 188.55

m = 149.79

TRUE OR FALSE? what is similar about the structure of all atoms is that they all have a nucleus made up of one or more protons and neutrons. Than electrons are located outside each nucleus

Answers

Answer:

the answer is true

Explanation:

whoever helps me will get brainlist

Answers

Answer:

Show us the arrows, how are we suppose to answer?

Explanation:

One problem with chemical reactions is that it is impossible to lower activation energy.

A) True
B) False

Answers

Answer:

false

Explanation:


the temperature will decrease the rate of reactions.

Answers

Answer:

true?

Explanation:

What is true about endothermic reactions?

Endothermic reactions release heat to the surroundings.
The enthalpy of products in endothermic reactions is lower than the enthalpy of reactants.
The enthalpy of an endothermic reaction is positive.
Endothermic reactions have an enthalpy of zero.

Answers

Answer:

The enthalpy of an endothermic reaction is positive, I believe.

''The enthalpy of an endothermic reaction is positive'' is the true statement about endothermic reaction

What is enthalpy of endothermic reaction?

If a reaction absorbs more energy than releasing it, the reaction is considered as endothermic and enthalpy will be positive while on the other hand, if a reaction absorbs less energy and releasing more, the reaction is considered as exothermic and enthalpy will be negative.

So we can conclude that option C is the right answer.

Learn more about reaction here: https://brainly.com/question/26018275

The velocity of an object consists of its speed and..

A. Average speed
B. Distance
C. Displacement
D. Direction

Answers

Answer:

direction

Explanation:

describe the three main concepts that make up cell theory

Answers

Explanation:

1.All living organisms are composed of one or more cells

2. The cell is the basic unit of structure and organisation in organisms

3.Cells arise from pre-existing cells

A 220.0 mL sample of helium gas is in a cylinder with a movable piston at 105 kPa and 275 K. The piston is
pushed in until the sample has a volume of 95.0 mL. The new temperature of the gas is 310 K. What is the new
pressure of the sample?
274 kPa
216 kPa
Piston
243 kPa
51.1 kPa


Answers

Answer:

Explanation:

what did you get?

give an example of liquid diffusing into a solid​

Answers

Answer:

Mecury almagamated zinc

8.2 moles of ethanol is boiled, how much energy was required to do so?

AH fus=4.60 kJ/mol
AHvap=43.5 kJ/mol

Answers

Answer:

Explanation:

Understand that a substance's specific heat (C) is a property that can be used to ... Calculate the heat required to melt 25.7 g of solid methanol at its melting point. ... How many moles of NH4NO3 must be dissolved in water so that 88.0 kJ of heat ... to vaporize 54.0 g of ethanol (C2H5OH) if AHvap for ethanol = 43.5. kJ/mol?

Other Questions
The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ? Which linear equation is written in slope-intercept form? Does the timing of a tsunami affect its impact? A 1.5m tall boy casts a 3m shadow. Calculate the height of a tree that simultaneously casts an 8m shadow. Please help choose oneA B C or D??? I have 3 Health questions about babies and pregnancies if any ladies can help me with these questions. Im failing this class and need to majorly bring my grade up. If there are any ladies that can help me with these's questions I'll give them Brainliest. ( Please only answer if you can actually help). I also have English questions to anyone can help with those questions. Im also failing English to. Just click on my name and go to my questions. Knives should be stored in cluttered drawers.True or false Consider the Tips for Responsible Financial Decisions discussed in this module. Using some of these tips, what advice would you give Brian on at least one of his financial decisions? How will your advice help Brian reach his financial goal? What is the volume of the square pyramid, in cubic inches? PLZZZZ HELP ME ,Plsss