Skylar goes to a school which has 1000 students in it.She asks 40 random students whether they like the new 8.30 am start to the day. 30 of them say ‘no’ they do not like it. Use this information to estimate how many students in the whole school dislike the 8.30 am start

Answers

Answer 1

Answer:

Step-by-step explanation:

30 out of 40 could be used to estimate that 750 out of 1000 would say 'no'

30/40 equals 3/4

3/4 of 1000 is 750


Related Questions

Emily bought 4 cheeseburgers for $6 each and then spent $18 on a new shirt. She paid for the cheeseburgers and shirt with her debit card. The change to Emily's bank account can be found using the expression below:

4(-6) + (-18)

Which of the integers below shows the change in balance to Emily's bank account?
28
-42
-64
6

Answers

-42 would be the answer
-42 would be the answer to your question

Lily used lime green, pink, blue, orange and yellow to make the bracelet. What fraction of the bracelet was the pink, blue and orange?

Answers

the answer is 3/5 or 0.12

Write the ratio as a fraction in simplest form, with whole numbers in the numerator and denominator

4 : 2.4​

Answers

Answer:

4:2.4 = 4/2.4

= 40/24 = 5/3 = 1 1/3

please help me and don't put sum bs answer or a link

Answers

Answer:

Both X and Y are equal to 15 multiply by the square root of 2.....(i just do not know how to type the symbol on my keyboard)

Step-by-step explanation:

So for X:

X=30 sin 45

=15 multiply by the square root of 2

For Y:

Y=30 cos 45

=15 multiply by the square root of 2

But you could also use theorem of Pythagoras

Can someone plz help ASAP

Answers

Answer:

55

Step-by-step explanation:

5×(2+5+2)=35

4×5=20

35+20=55

Find the missing angle measure in each triangle 29, 88, x || Hurry :)

Answers

Answer:

63

Step-by-step explanation

180-29-88=63

This Inflatable Crayon has a diameter of 8 in a length of 40 inches and is topped with a cone shaped tip with a height of 12 inches Round your answer to the nearest tenth of an inch.

Answers

Answer:

Assuming you want to know the volume,

volume = 2210.6 in³

Step-by-step explanation:

radius = diameter/2 = 8/2 = 4 in

area of base = πr² = (3.14)(4²) = 50.24 in²

volume of tube portion = base area x height = 50.24 x 40 = 2009.6 in³

cone volume = 1/3bh = 1/3(50.24)(12) = 200.96 in³

total volume = 2009.6 + 200.96 = 2210.56 in³

The product of two rational numbers

Answers

Answer:

The product of two rational numbers is rational.

So, multiplying two rationals is the same as multiplying two such fractions, which will result in another fraction of this same form since integers are closed under multiplication. Thus, multiplying two rational numbers produces another rational number.

Please help!
The distance between two tall buildings is 480ft. While standing on the roof of the shorter building, an inquisitive geometry student measures the angle of descent to the base of the taller building to be 48 degrees. She also measures the angle of elevation to the top of the taller building to be 25degrees. How tall is the shorter building? How tall is the taller building?

Answers

Answer:

450ft

Step-by-step explanation:

In the picture

A. A
B. B
C. C
D. D

help plz im timed​

Answers

Answer:

A) (0,0)  B)(1,1)  C) (0,1)  D) (1,0)

Step-by-step explanation:

6 months ago, Juan used his credit card for a transaction of 128 dollars. The bank charges a rate of interest
of 50% per month compounded monthly
How much does Juan owe to the bank today?

Answers

The compound interest implies that Juan owes $163.52 today

How to determine the amount Juan owes?

The given variables can be represented as:

Loan amount P = $128Rate of interest, R = 50%Time to pay back the loan, t = 6 months i.e. 0.5 year

The amount from a compound interest can be calculated using:

A = P(1 + r/n)^nt

Also from the question, we have

n = 12

This is so because the loan is compounded 12 times in a year as a result of being compounded monthly

So, we have

A = P(1 + r/n)^nt

A = 128 * (1 + (50%/12))^(0.5*12)

Evaluate

A = 163.52

Hence, the amount owed is $163.52

Read more about compound interest at:

brainly.com/question/2455673

#SPJ1

Linear function last one

Answers

Answer:

y=1/2x

Step-by-step explanation:

y=-x would go the other way so cross that one

y=2x would go up really quickly so cross that one

y=0.001x would be more like a horizontal line so cross that one

y = 1/2 is correct  

Find the area of a circle with radius equal to 7π

Answers

Answer:

49π³

Step-by-step explanation:

area = πr²

area = π(7π)² = 49π³

Answer:

1519.3 sq units

Step-by-step explanation:

A = πr²

A = π(7π)²

A = 49π³

The Miller family likes to petal along the north River. 1. They paddled the same distance each day throughout the course of three days, traveling a total of 14 miles. How many miles do they travel each day?

Two. If the millers went half their daily distance each day, but extend their trip to twice as many days, how far would they travel?

Answers

Answer:

The Millers paddled 4,666 miles each day.  If they reduced their daily distance by half, extending their trip to twice as many days, the distance traveled by the Millers would have been the same.

Step-by-step explanation:

Given that the Miller family likes to paddle along the river, and they paddled the same distance each day throughout the course of three days, traveling a total of 14 miles, to determine how many miles did they travel each day the following calculation must be performed :

14/3 = X

4.666 = X

Thus, the Millers paddled 4,666 miles each day.

In turn, if the Millers went half their daily distance each day, but extend their trip to twice as many days, to determine how far would they travel, the following calculation must be performed:

4.666 / 2 x 6 = X

2.333 x 6 = 13.9999

Thus, the distance traveled by the Millers would have been the same.

3.
At time t = 0 years, a forest preserve has a population of 1500
deer. If the rate of growth of the population is modeled by
R(t) = 2000e0.231 deer per year, what is the population at time
t=3.

Answers

The population of deer at time t=3 years is approximately 4128 deer.

What is an exponential function?

An exponential function is a mathematical function of the form [tex]f(x) = a^x[/tex], where a is a positive constant called the base, and x is the input variable. The exponent x represents the power to which the base a is raised.

The rate of growth of the deer population is given by the function [tex]R(t) = 2000e^{(0.231t)}[/tex], where t is the time in years since t=0.

To find the population at time t=3, we need to evaluate R(3) using the given function:

[tex]R(3) = 2000e^{(0.231\times 3)[/tex]

[tex]R(3) = 2000e^{0.693}[/tex]

R(3) ≈ 4127.72

Therefore, the population of deer at time t=3 years is approximately 4128 deer.

To know more about an exponential function follow

https://brainly.com/question/30135888

#SPJ2

Martin buys a car for $15,000. The value of the car depreciates by 7% each year. What is the value of his car 5 years after he purchased it? Round to the nearest dollar. can somone help asap?

Answers

Answer:

5250

Step-by-step explanation:

you multiply 7 times 5 then it gives you 35 then you

Can someone please help me find the answer?

Answers

Answer:

149.84

Step-by-step explanation:

Pleaseee helppp!!! I’m not sure

Answers

Answer:

It’s A, 8(7+8+16)
Hope this helps!

a box of 8 marbles has 4 red,2 green and 2 blue marbles. If you select one marble, what is the probability that it is a red or blue marble

Answers

your answer should be 0.80

a bank receives a deposit for $30000. If the bank has a 10 percent reserve requirement approximately how much money could be initial deposit eventually add to the econmy

Answers

It might be 30000 maybe

Given sec A = 5/3 and that angle A is in Quadrant I, find the exact value of csc A in simplest radical form using a rational denominator.​

Answers

9514 1404 393

Answer:

  5/4

Step-by-step explanation:

The relationship between the sec and csc functions is ...

  csc(A) = sec(A)/√(sec²(A) -1)

For the given value of sec(A), this is ...

  csc(A) = (5/3)/√((5/3)² -1) = (5/3)/√(16/9) = (5/3)/(4/3)

  csc(A) = 5/4

__

Some calculators can tell you the answer directly.

P(A)=0.45, P(A∩B)=0.15 and P(B\A)=0.25 what is the value of P(A\B)

0.45
0.25
0.35
None of the above

Answers

Answer:

0.35? That is correct?

Two variables are said to interact when ____. a. the two variables are differentially affected by a third variable b. both variables produce a change in the subjects' scores c. both variables are equally influenced by a third factor d. the effect of one independent variable depends on the levels of the second variable

Answers

Answer:

a.) the effect of one independent variable depends on the levels of the second variable

Step-by-step explanation:

In regression, an interaction effect comes to play whenever the effect that an independent variable has on a dependent variable changes, as regards to value(s) of other independent variables( one or more variables). The variables that give interaction effect as a result of interaction with each other is reffered to as "interacting variables" For instance, in a research whereby how "Male gender versus female gender" and their " dieting B and dieting D" influence their " weight loss" There would be interaction effect in a situation where by a " female gender" that operate on " diet B" shed more weight compare with " male gender" that operate on " diet B". It should be noted that two variables are said to interact when the effect of one independent variable depends on the levels of the second variable

Help please and explain

Answers

Answer:

Volume of a cone = 50 in³

Step-by-step explanation:

diameter = 5 in

radius = 2.5 in

height = 8 in

Volume of cone = [tex]\frac{\pi r^2h}{3}[/tex]

V = (3 × 2.5 × 2.5 × 8)/3

V = 150/3

V = 50 in³

PLEASE HELP, ITS URGENT I WILL GIVE BRAINLY...
Shopping for school supplies, you recently spent $22 to purchase a notebook, a box of pencils, and a package of pens. The box of pencils costs $2 less than the notebook. The package of pens costs 3 times as much as the box of pencils. Choose a variable. Define the variable. Write and solve an algebraic equation to find the cost of each item you purchased. Please show work for Notebook and Box of Pencils and Package of pens. And an equation. (I WILL GIVE POINTS AND BRAINLY PLEASE HELPPPPPPP)

Answers

Answer:

Cost of the box of pencils = x = $4

Cost of the notebook = x+2 = 4+2 = $6

Cost of package of pens = 3x = 3(4) = $12

Step-by-step explanation:

Let the cost of the box of pencils = x

Cost of the notebook = 2 more than the pencils cost = x+2

Cost of package of pens = 3 times the pencils cost = 3x

The total was $22, so we can say:

(x)+(x+2)+(3x) = 22

5x=22-2

x=20/5

x=$4

Cost of the box of pencils = x = $4

Cost of the notebook = x+2 = 4+2 = $6

Cost of package of pens = 3x = 3(4) = $12

find the perimeter of the figure below.

PLEASE GIVE A EXPLANATION

Answers

Answer:

Perimeter of the figure = 198.54 feet

Step-by-step explanation:

Given figure comprises a rectangle and two semicircles.

Perimeters of two semicircle = 2πr

Here 'r' = Radius of the circle

Perimeter of two semicircles at the sides of the rectangle = [tex]2\pi (\frac{25}{2})[/tex]

= 25π feet

= 78.54 feet

Length of side AB = Length of side CD = 60 feet

Perimeter of the given figure = 2(60) + 78.54

                                                = 198.54 feet

What type of fraction is 26 1/3?

Answers

It is known as a mixed fraction.

Mrs. Hampton’s class is studying the feeding habits of captive turtles in the community. Which of these samples represents the best random sample for the study?
A.
some turtles at the local reptile zoo and some turtles kept as pets
B.
all the turtles found in science classrooms at the school
C.
every other turtle the class finds in the pond behind their school
D.
every third turtle that appears on the beach near the lake

Answers

Answer:

A

Step-by-step explanation:

I just took the test

:>

Answer:

I hope this helps

Step-by-step explanation:

Find the acceleration. I don’t understand this, please help

Answers

Answer:

At t = 9, Whitney's acceleration will be -0.2 miles per minute.

Step-by-step explanation:

Remember that the acceleration is the derivative of velocity.

Since we want to find Whitney's acceleration at t = 9 and we are given the velocity function, we can simply find the derivative of the point at t = 9. In other words, a(9) = v'(9).

For the interval (7, 11), we simply have a line. So Whitney's acceleration at t = 9 will be equivalent to the slope of that line.

We have the two points (7, 0.8) and (11, 0). So, the slope between them is:

[tex]\displaystyle m=\frac{0-0.8}{11-7}=\frac{-0.8}{4}=-\frac{1}{5}[/tex]

So, a(t) = v'(t) = -0.2 ∀t ∈ {t | 7 < t  < 11}. Then at t = 9, Whitney's acceleration will be -0.2 miles per minute.

Use this list to find the range: 53, 66, 68, 68, 75, 75, 75, 79, 82

(This is from Edginuity btw)

Answers

Answer:

29

Step-by-step explanation:

Answer:

29

Step-by-step explanation:

Range =Largest - smallest

82 - 53=

29

Other Questions
Jack invested $2,900 in an account paying an interest rate of 8 % compoundedannually. Anthony invested $2,900 in an account paying an interest rate of 81%compounded continuously. After 10 years, how much more money would Anthonyhave in his account than Jack, to the nearest dollar?I dont understand how to solve. I NEED HELP PLEASE HURRY The bank has 5 Vaults.Each vault contains 5 drawers 5 stacks and $25 whats in the bank? How many solutions will the equation have?| x 2| = 6 giving brainliest !!!!!!! What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent.