Select the correct answer.
Which sentence uses correct spelling, punctuation, and grammar?
O A. Just slightly larger than nearby Venus, Earth is the biggest of the terrestrial planets.
OB.
In the Summer seasons' my dad likes to take an annual fishing trip to the Mountains.
O c.
The City of Los Angeles is home to many people of different backgrounds and ethnicities.
OD.
Lake superior covers 31,700 square miles, it is the largest lake by area in the United States.

Select The Correct Answer.Which Sentence Uses Correct Spelling, Punctuation, And Grammar?O A. Just Slightly

Answers

Answer 1
The answer is A, I believe. Hope this helps! :)

Related Questions

Which statement about iambic pentameter, which is used in "Sonnet 29,” is correct?

Answers

Answer:

An iamb consists of two unstressed syllables followed by two stressed syllables.

I turned to Mr. Gleason. He was chasing a pea around his plate. Several times he got it to the edge, but when he tried to pick it up with his chopsticks, it rolled back toward the center of the plate again. Finally he put down his chopsticks and picked up the pea with his fingers. He really did! A grown man!

Answers

Answer:

4. It allows the narrator to see other people struggling with new cultures.

Explanation:

This allows the narrator to see other people struggling with new cultures. The entire event of the story revolves around Mr. Gleason not being able to pick up the round pea with his chopsticks. This was most likely due to him having very little to no practice using chopsticks because it is not part of his culture. Therefore, this task became very difficult and frustrating for him, up to the point where he decided to abandon the use of chopsticks and use his fingers which were much easier. Therefore, the entire event led to the resolution of the frustration and struggle that Mr. Gleason had with the new culture.

Answer:

The last one

Explanation:

In this story it tells about a immigrant who struggles with American customs. This Expert tells us that the narrator is not the only one that struggles getting used to other customs.

What themes can you identify from the video may be present in the story Frankenstein? Do you think that Shelley’s life experiences contributed to the contents of the horror story as mentioned in the video? If so, how?

Answers

Answer:

This is an opinion question. there is no right of wrong answer, the only thing you can do to get a bad grade is not to be careful with your wording and spelling

Explanation:

It is an opinion question it would be an abolishment for me to answer for you.

Key Ideas and Details: In paragraph 7, Roosevelt asserts that Americans are bound together by what?

Answers

Roosevelt thinks that our shared future aspirations bind us all together. In support of his claim, he highlighted "the knowledge that we are all connected together by hope of a common future rather than by reverence for a common past."

Who is Franklin D. Roosevelt?

Franklin Delano Roosevelt was an American political leader. Franklin Delano Roosevelt was born on March 4, 1933, and died on April 12, 1945. Franklin D. Roosevelt served as the thirty-second president of the united states of America.

Roosevelt is renowned for a number of reasons, including becoming the United States youngest president.

Roosevelt believes that our common goals for the future link us all together. He emphasized "the knowledge that we are all bound together by hope of a common future rather than by reverence for a common history" to bolster his assertion.

Learn more about Franklin D. Roosevelt here:

https://brainly.com/question/25902541

#SPJ5


Which part of the story begins the development of a character?

Answers

The exposition because that’s what introduces many of the background info and ideas of the story and setting as well as the characters

Question 7 of 10
If a reader wants to evaluate a text, which is the best question to ask while
reading it?
о O
A. What are the goals of the text, and what elements help achieve
those goals?
O B. How long is this text, and how quickly does it get to the point?
C. Where else is there a text with similar goals that used different
elements?
D. When did the author of this text decide on its goals, and when did
he write it?

Answers

A is the best when analyzing the text and purpose of the text
If i’m not mistaken it’s A

Botsmarts 100 100 100 100 100 100

Answers

Answer:

huh

Explanation:

Answer:?????

Explanation:

Read the following passage and answer the question.

He has made her, morally, an irresponsible being . . . In . . . marriage, she is compelled to promise obedience to her husband, he becoming, to all intents and purposes, her master . . .

What inferences, or conclusions can be drawn regarding the typical husband and wife relationship in 1848?

Women secretly controlled their husbands.
Women had to obey their husbands even if they were wrong.
Men were afraid of their wives.
Men and women rarely married.

Answers

women had to obey their husbands even is they were wrong

Answer:

women had to obey husband

Explanation:

when she _________ the job, she knew that she would have to move to chicago.
a. accepted
b.accepts
c.excepted
d.excepts
helllllllp meeeeeeeeeeeeeeeeeee

Answers

Answer:

it is A

Explanation:

PLEASE HELPP ILL GIVE BRAINLIST
when you suddenly find your tongue twisted and your speech stammering as you seek to explain to your six-year-old daughter why she can't go to the public amusement park that has just been advertised on television, and see the tears welling up in her little eyes when she is told that Funtown is closed to colored children, and see the depressing clouds of inferiority begin to form in her little mental sky…
Type of figurative language:
Meaning of figurative language:
Effect on tone and mood:
Effect on audience:


Like a boil that can never be cured as long as it is covered up but must be opened with all its pus-flowing ugliness to the natural medicines of air and light, injustice must likewise be exposed, with all of the tension its exposing creates, to the light of human conscience and the air of national opinion before it can be cured.
Type of figurative language:
Meaning of figurative language:
Effect on tone and mood:
Effect on audience:


Over and over again I have found myself asking: "Who worships here? Who is their God? Where were their voices when the lips of Governor Barnett dripped with words of interposition and nullification? Where were their voices of support when tired, bruised, and weary Negro men and women decided to rise from the dark dungeons of complacency to the bright hills of creative protest?"
Type of figurative language:
Meaning of figurative language:
Effect on tone and mood:
Effect on audience:


In those days the Church was not merely a thermometer that recorded the ideas and principles of popular opinion; it was a thermostat that transformed the mores of society.
Type of figurative language:
Meaning of figurative language:
Effect on tone and mood:
Effect on audience:


It was "illegal" to aid and comfort a Jew in Hitler's Germany. But I am sure that, if I had lived in Germany during that time, I would have aided and comforted my Jewish brothers even though it was illegal.
Type of figurative language:
Meaning of figurative language:
Effect on tone and mood:
Effect on audience:

Answers

Answer:

Type of figurative language:  metaphor

Meaning of figurative language:  clouds of inferiority refers to the way segregation led to African Americans to thinking of themselves as "less than"

Effect on tone and mood:  It makes the abstract have a darker tone, of sadness and impotence

Effect on the audience: it transmits the impotence of the parent when explaining to their child why they can't go to the amusement park and in a broader sense how they are "less than"

Explanation:

Metaphors are used to connect or compare two ideas that are not literally compatible, but figuratively make sense. The author here compares the feeling of inferiority that stops their children from reaching their potential with clouds that cover up the sky, thus stopping "colored" children from seeing themselves as equal and capable of doing the same things as their "non colored" peers

Explanation:

WILL MARK BRAINLIEST!!
Which is an example of paraphrasing?

A. The immigrants next stop after landing in the states was Ellis island. This was the place where they would be given health exams and other tests to see if they would be allowed to stay. Many feared the tests because they did not want to be sent back to their homeland.

B. “Filling into an enormous inspection hall, the immigrants formed long lines separated by iron railings...”

C. One author says, “Before they could be admitted to the United States, immigrants had to pass through Ellis Island, which became the nations chief immigrant processing center in 1892. There they would be questioned and examined.

D. Freedman writes about Ellis island, “Officials hurried them along, shouting ‘Quick! Run! Hurry!’ In a half a dozen languages.”

Answers

Answer:

The answer is c, I believe

Explanation:

Paraphrasing means to restate a text or passage to clarify what the text or passage is trying to say, summarizing basically. Answer c best depicts what the author is trying to say, but more clearly and shorter. Does that make sense?

(there is a possibility that is a answer A as well.)

Change the phrase below into a possessive noun phrase.

a performance by Frances

Possessive noun phrase:

Answers

Answer:

noun clause

Explanation:

it function as a abject

1. Who was Olaudah Equiano?

2. Describe the space Equiano was kept on the ship. Provide at least 4 descriptive phrases.

3. What happened to slaves who tried to jump off the ship?

4. Make an inference – What do you think Equiano is referring to when he says, “ necessary tubs”? What evidence supports this answer?

Answers

Answer: He was a slave who wrote about his amazing experiences. He was born in 1754 and died in 1797.  When he boards the ship he fears that the white man will kill and eat him. He was scared because he is young and has never seen a white man before. When Equiano is forced below deck he gets sick because of the smell.

Explanation:

Who has read A Lesson Before Dying?

Answers

Answer:

Not me, but it seems like a really good book!

Explanation:

Two important things happened during Frankenstein's childhood that put him
on the road to destruction. Name one of those things.

Answers

Answer:

The stranger, who the reader soon learns is Victor Frankenstein, begins his narration. He starts with his family background, birth, and early childhood, telling Walton about his father, Alphonse, and his mother, Caroline. Alphonse became Caroline’s protector when her father, Alphonse’s longtime friend Beaufort, died in poverty. They married two years later, and Victor was born soon after.

Explanation:

–4(x – 26) = –200
x =

Answers

Answer: 76

Explanation:

Rearrange the equation by subtracting what is to the right of the equal sign from both sides of the equation :

                    -4*(x-26)-(-200)=0

Step by step solution :

STEP

1

:

Equation at the end of step 1

 (0 -  4 • (x - 26)) -  -200  = 0

STEP

2

:

STEP

3

:

Pulling out like terms

3.1     Pull out like factors :

  304 - 4x  =   -4 • (x - 76)

Equation at the end of step

3

:

 -4 • (x - 76)  = 0

STEP

4

:

Equations which are never true

4.1      Solve :    -4   =  0

Solving a Single Variable Equation:

4.2      Solve  :    x-76 = 0

Add  76  to both sides of the equation :

                     x = 76

One solution was found :

x = 76

(1) As she was driving to visit her twin, Jayla had a strange feeling that something bad was going to happen.

(2) Meanwhile, Kayla had the same exact premonition.

(3) Worried about her sister, Kayla called Jayla's cell phone.

(4) Because she took her eyes off the road to answer the phone call, Jayla lost control of her car and crashed through the front of Kayla's house.



Which sentence features an introductory clause that explains why the main action happened?
Sentence 1
Sentence 2
Sentence 3
Sentence 4

Answers

Answer:

The answer would be sentence 4

Explanation:

Answer:

D/ sentence 4

Explanation:

Explain what Creon means when he says, “I am not the kind of man to bear this tamely.”

Answers

fornite ig irld ccccccccccccccccccccccccccccccccccccccdddddddddddddddddddddddddd

Read the excerpt from “The Divine Image” by William Blake. Which meter is used in the third line?

For Mercy, Pity, Peace, and Love
Is God, our father dear,
And Mercy, Pity, Peace, and Love
Is Man, his child and care.

A.
iambic trimeter (The foot has an unstressed syllable followed by a stressed syllable. This pattern repeats three times in the line.)
B.
trochaic dimeter (The foot has a stressed syllable followed by an unstressed syllable. This pattern repeats two times in the line.)
C.
trochaic trimeter (The foot has a stressed syllable followed by an unstressed syllable. This pattern repeats three times in the line.)
D.
iambic tetrameter (The foot has an unstressed syllable followed by a stressed syllable. This pattern repeats four times in the line.)

Answers

Answer:

iambic tetrameter (The foot has an unstressed syllable followed by a stressed syllable. This pattern repeats four times in the line.)

Explanation:

Hope this helps!

The excerpt from “The Divine Image” by William Blake. iambic tetrameter (The foot has an unstressed syllable followed by a stressed syllable. This pattern repeats four times in the line.) is used in the third line.

What is Iambic tetrameter?

It refers to the line connecting the four feet of the iambic. The word "tetrameter" simply means that there are four feet in a row;

How many lambs are there in Iambic tetrameter?

Iambic tetrameter is a line consisting of four iambs, which are defined by a pronunciation.

Hence, the correct answer is Option D

Learn more about iambic tetrameter on https://brainly.com/question/64521

#SPJ2

Which one of these is the main purpose of the table of contents

Answers

Answer:

Where is the choice which one to choose...

Answer:

The table of contents serves two purposes: It gives users an overview of the document's contents and organization. It allows readers to go directly to a specific section of an on-line document.

Explanation:

THIS IS THE PURPOSE

Henry bessemer information about their family

Answers

Answer:

Henry Bessemer

Birthdate: 1813

Death: 1898 (84-85)

Immediate Family:  

Son of Anthony Bessemer and Elizabeth Bessemer

Husband of Anne Bessemer

Father of Alfred George Bessemer and Henry Bessemer

Explanation:

I hope I have helped! :)

What is the author's MAIN point in paragraph 2?
O A. The Lomax family helped popularize the best
artists of blues music.
B. The Lomax family helped preserve the rich
history of blues music.
C. The Lomax family helped prove the superiority
of blues music.
D. The Lomax family helped provide evidence of
the blues music.

Answers

Answer:

I believe that it is b

Explanation:

Answer:

B

Explanation:

Write a letter to the district director of education asking for assistance​

Answers

Answer:

like a letter or wht are you talking abt?

Explanation:

Jane Yatman never challenged Jane Lindsay's 800-mile record. Instead, she found a new venue for her long-distance cycling. In 1900, she rode from New York to Chicago—approximately 1,050 miles—in 254 hours and 40 minutes. The statements in this excerpt are objective because they

Answers

This question is missing the options. I've found the complete question online. It is the following:

Jane Yatman never challenged Jane Lindsay's 800-mile record. Instead, she found a new venue for her long-distance cycling. In 1900, she rode from New York to Chicago-approximately 1,050 miles-in 254 hours and 40 minutes.

The statements in this excerpt are objective because they

A. contain facts that can be proven.

B. offer personal beliefs and opinions.

C. include debatable details and ideas.

D. persuasive words and phrases.

Answer:

The statements are objective because they:

A. contain facts that can be proven.

Explanation:

Objective statements should not be debatable, nor should they express one's opinions and beliefs. Those characteristics make a statement subjective and/or biased, meaning they are questionable or simply based on someone's feelings and inferences. Objective statements focus on facts that can be proven, events that have been recorded somehow. That is why the statements we are analyzing here are objective ones. They concern facts that are certainly recorded in documents or newspapers. Notice how precise the dates, distances and time are.

Answer:

A

Explanation:

Identify the sentence that is an example of an analogy.

A) Hammer is to pound as needle is to sew.

B) Her eyes were as blue as the sky.

C) Jordi is a racehorse.

Answers

Answer:b

Explanation:I did in edgenuety

Answer: Option A.

Explanation: Comparison between two things.

Correct the error of faulty parallelism in the following sentence.

We found the dessert both delicious and filled us up.

Answers

Answer:

We found the dessert both delicious and filling.

Hope this helped <3

Delicious and fulfilling will be the correct manner in which the sentence should be written.

What is an error of faulty parallelism?

When the parts of speech in a sentence don't communicate in the same manner, it is a grammatical mistake known as imperfect parallelism.

Because items in a sequence don't share the same grammatical structure, it's called faulty parallelism. Here are some examples of improper parallelism in paragraphs, followed by corrections.

We found the dessert both delicious and fulfilling will be the correct form of sentence that will be used. Due to the two distinct elements of the sentence—"delicious" and "filled us up," which do not appear in the same form—the sentence does not have a structure that is parallel.  As a result, the sentence's two sections take on a parallel structure.

Learn more about the error of faulty parallelism, here:

https://brainly.com/question/18466822

#SPJ3

Which three words will you most likely see in an argumentative prompt?
A).Oppose.
B).Central idea.
C).Argue.
D).Theme.
E).Support.​

Answers

Answer:

C, argue, D, theme, and B, central idea

Explanation:

i skipped these and i still don’t understand

Answers

Allison calls her friends every day.

Ellen and Matt run around the yard.

Spaghetti and meatballs are on the menu tonight.

Answer:

7. A. Calls

8. A. runs

9. B. are

Explanation:

Hot summers and cold winters best define a __________ climate region.
A.
subarctic
B.
highlands
C.
humid continental
D.
marine west coast

Answers

Answer:

the answer is c

Explanation:

just did it

Answer:

c. humid continental

Explanation:

i got it right on ed2020

i will brian list first right answer

Answers

1. Dynamic
2.Protagonist
3.Antagonist
4.Static

Hoped it helped :)

Answer:

1.  dynamic

2. protagonist

3. antagonist

4. static

Explanation:

Other Questions
Step by StepWrite a set of directions for a red blood cell to deliver oxygen to the brain. Include all the words in the word bank.lungs,heart,brain,aorta,arteries,veins1.2.3.4.5.6.(help me never mind) There Are 13 Girls And 17 Boys In Juan's Math Class Girls Are What Fraction Of The Class? Boys Are What Fraction? Girls= Boys= If you are def, what language do you think in sandy has several pitchers to hold lemonade The perimeter of a triangular garden is 78 feet. Find the length of the three sides if the middle length side is 3 feet greater than twice the length of the smallest side, and the longest side is 3 feet less than 3 times the length of the smallest side. write different states of matter Which events are likely to be catastrophic to an ecosystem? Select the twocorrect answers.O A. Massive floodingO B. Steady population growthO C. Introduction of an unchecked invasive speciesD. Spring thunderstormO E. Species competition What is a "Climate system"?Pls help and if you can explain Lee's uncle is installing a new pool in his backyard. The pool is a square and has an area of 121ft^2. He decides to build a 4 ft wide deck to surround the pool. What is the outside perimeter of the deck? The small square is the pool and the deck is the big square Eukaryotic cells are differentiated from prokaryotic cellsbecause eukaryotic cells what is the value of y in the proportion? How many kilograms do you have with 100g of tortillas similarities between the Texas Declaration of Independence and the United States Declaration of Independence. PLEASEEE HELPPPPConsider the equation:4A1+302 - 2Al2O3Is this equation balanced? Why or why not? The concepts listed above were included in the United States Constitution in order to- limit the powers of government limit the powers of government copy the British system of government copy the British system of government establish a strong militia establish a strong militia put down rebellion in the western territories put down rebellion in the western territories Which actions by the British Parliament provoked the American colonies to revolt? how to say good day in spanish Which of the following is acomplete sentence?A. Since you are my friend, I feel it is safe toconfide in you.B. Although they didn't know what would comeout of that dark, forbidden looking cave in frontof them.C. Because she had cared so paitiently for thelittle crippled dog, and the bird with the brokenwing. Digest the sequences using Haelll. Person 1 GGCCTCGGCCTAGAACGGCCTAGCCG CCGGAGCCGGATCTTGCCGGATCGGC Person 2 CTGAGGCCTAAGCGATTCCCGGATATA GACTCCGGATTCGCTAAGGGCCTATAT Only these two questions, I need answers with proof!