Rebello's preferred stock pays a dividend of $1.25 per quarter, and it sells for $45.00 per share. What is its effective annual (not nominal) rate of return?
a. 11.58%
b. 13.10%
c. 5.56%
d. 11.11%
e. 11.42%

Answers

Answer 1

The effective annual rate of return for Rebello's preferred stock is 11.11% considering dividend payments and stock price, option (d) is correct.

To calculate the effective annual rate of return, we need to consider both the dividend payments and the stock price. First, let's determine the annual dividend payment. Since there are four quarters in a year, the annual dividend is calculated as 4 times the quarterly dividend

= 4 * $1.25

= $5.00.

Next, we divide the annual dividend by the stock price to obtain the dividend yield

= $5.00 / $45.00

= 0.1111

Finally, to convert the dividend yield to a percentage, we multiply it by 100

= 0.1111 * 100

= 11.11%.

Therefore, the effective annual rate of return for Rebello's preferred stock is 11.11%. This reflects the combined impact of both the dividend payments and the stock price on the overall return, option (d) is correct.

To learn more about stock follow the link:

https://brainly.com/question/14649952

#SPJ4


Related Questions

How has radical feminism in recent decades redefined what constitutes the ‘political’ in
discussions of politics’?
Group of answer choices
By arguing that politics must ‘stop at the front door’ and that the intrusion of politics into the private and family sphere inherently undermines a woman’s right to privacy
By arguing that the ‘political’ is inherently international, and like socialism, true feminism cannot be achieved domestically but can only be tackled as a global problem
By arguing that social, economic, and familial structures are inherently sexist and become mutually reinforcing institutions on which a sexist politics is built
By arguing that sexual equality rests primarily on the ‘political’ question – i.e., that increasing female participation and representation in politics is the ultimate solution to addressing sexism in other areas of life

Answers

Radical feminism in recent decades has redefined what constitutes the ‘political’ in discussions of politics’ by arguing that social, economic, and familial structures are inherently sexist and become mutually reinforcing institutions on which a sexist politics is built.

Radicale feminism has argued that social, economic, and familial structures are inherently sexist and become mutually reinforcing institutions on which a sexist politics is built. It is because of this understanding that the feminist movement’s aim is to dismantle the institutions that support patriarchy, rather than just changing the laws that enable it.The personal is political is a slogan that reflects the belief that personal experiences are rooted in and influenced by social and political structures. This sentiment emphasizes the significance of the seemingly insignificant or ‘private’ aspects of life, such as the relationships between individuals, family life, and personal beliefs.The phrase was first popularized by radical feminists in the 1960s and 1970s, who saw patriarchal structures as responsible for women’s marginalization.

To Learn more about political. Click this!

brainly.com/question/13086429

#SPJ11

The market value of a company equals $60 billion. Next year's estimated earnings equal $4 billion and the associated opportunity cost of capital is 10%. Assume that the value of the assets in place is calculated as the discounted value of earnings under a no-growth policy. What is the present value of growth opportunities (PVGO) for this company? Please provide your answer to the nearest whole number, in USD billions without a dollar sign (e.g. 100 instead of $100).

Answers

The Present Value of Growth Opportunities (PVGO) for the company is approximately $20 billion. PVGO represents the value of future growth prospects and is calculated by subtracting the value of assets in place from the market value of the company.

To calculate the PVGO, we need to determine the value of assets in place. This value is derived by discounting the estimated earnings under a no-growth policy using the opportunity cost of capital.
Value of assets in place = Earnings / Opportunity Cost of Capital

= $4 billion / 0.10

= $40 billion
Next, we subtract the value of assets in place from the market value of the company: PVGO = Market Value - Value of Assets in Place

= $60 billion - $40 billion

= $20 billion

Therefore, the PVGO for this company is approximately $20 billion.

To learn more about PVGO:

https://brainly.com/question/29455664

#SPJ11

1.What do we mean by the optimum capital structure management ? 2. Why would a shareholder prefer a high EPS (earning per share) ratio ? Explain 3. What is the difference between present value, net present value and future value
4. What is a Company's value in the independence position ? 5. List 2 benefits of proceeding with a share price and 2 benefits of proceeding of a share buy back

Answers

1. Optimum capital structure management refers to finding the ideal balance between debt and equity financing that maximizes a company's value and minimizes its cost of capital.

2. Shareholders prefer a high EPS (earnings per share) ratio as it signifies that the company is generating strong profits on a per-share basis, leading to increased dividends, higher stock prices, and potential capital gains.

3. Present value represents the current worth of future cash flows, considering the time value of money. Net present value (NPV) is the difference between the present value of cash inflows and outflows, assessing the profitability of an investment.

4. A company's value in the independence position refers to its intrinsic worth derived solely from its assets, operations, and financial performance without external influences like mergers or acquisitions.

5. Benefits of proceeding with a share price include increased liquidity in the stock market and potential access to capital. Benefits of a share buyback include improving earnings per share (EPS) and signaling the company's belief in undervaluation.

1. Optimizing the capital structure involves determining the appropriate mix of debt and equity based on factors like risk, profitability, and financial flexibility. It helps to lower financing costs, increase financial leverage, improve creditworthiness, and enhance shareholder value.

2. A high EPS ratio indicates a company's financial health, growth potential, and ability to distribute profits to shareholders. It attracts investors, enhances market reputation, and can provide a steady income stream through increased dividend payouts.

3.  Future value calculates the value of an investment or cash flow at a future point, accounting for compounding. Present value helps compare cash flows at different times, NPV evaluates investment profitability, and future value estimates growth over time.

4. The value in the independence position serves as a reference point for valuation, fair market transactions, and assessing the company's financial health.

5. A higher share price attracts investors, enhances market liquidity, and facilitates equity financing. Share buybacks increase EPS and demonstrate confidence in the company, potentially boosting the stock price.

To know more about stock market visit:

https://brainly.com/question/7550583

#SPJ11

Which of the following results in the production of a positive externality? a A homeowner does not maintain his property b A person buys land to perserve open space that is enjoyed by all passerbys c Your neighbor has a loud party that lasts until 4 AM d A factory dumps industrial waste into a nearby lake, poisoning the fish population

Answers

The answer is b) A person buys land to preserve open space that is enjoyed by all passerbys.

A positive externality is a benefit that is enjoyed by a third party that is not directly involved in the transaction. In this case, the person who buys the land to preserve open space is not directly benefiting from the open space, but others who pass by the land do benefit from it. This is because the open space provides a place for people to relax and enjoy nature, and it also helps to improve the air quality.

The other options do not result in the production of a positive externality. In option a, the homeowner is not maintaining his property, which could lead to a decline in the value of surrounding properties. In option c, the neighbor's loud party is a negative externality, as it is a nuisance to the neighbors. In option d, the factory is dumping industrial waste into a nearby lake, which is a negative externality, as it is polluting the water and harming the fish population.

In more detail, a positive externality occurs when the production or consumption of a good or service benefits a third party who is not directly involved in the transaction. In this case, the person who buys the land to preserve open space is not directly benefiting from the open space, but others who pass by the land do benefit from it. This is because the open space provides a place for people to relax and enjoy nature, and it also helps to improve the air quality. The other options do not result in the production of a positive externality because they either do not benefit a third party or they harm a third party.
To learn more about externality here brainly.com/question/24233609

#SPJ11

Describe the collective-action problems in revolutions and
summarize how groups solve them.

Answers

Collective-action problems in revolutions refer to the challenges faced by groups of individuals in coordinating their actions and achieving collective goals amidst conflicting interests and incentives. These problems arise due to factors such as free-riding, coordination difficulties, and information asymmetry.

To overcome these challenges, groups often employ various strategies. Firstly, establishing strong leadership and organizational structures can help provide direction and coordination. Leaders can articulate a clear vision, motivate participants, and facilitate decision-making processes.

Secondly, creating a sense of shared identity and common purpose among the group members can enhance cooperation and solidarity. This can be achieved through shared symbols, narratives, and ideologies.

Thirdly, creating incentives and disincentives can encourage participation and deter free-riding behavior. Offering rewards or benefits for active engagement or imposing sanctions for non-participation can align individual interests with collective goals.

Lastly, effective communication and information-sharing mechanisms can reduce information asymmetry and promote better coordination among group members.

To learn more about Collective-action, visit:

https://brainly.com/question/9998972

#SPJ11

The Make-Buy Decision Process - In-sourcing and Out-sourcing
Length and format: 800 words in length - APA format
Topic
As you have studied in Chapter 6, Supply Chain enterprises must decide what to manufacture and what to purchase. This is the Make-Buy Decision Process, also known as Insourcing vs. Outsourcing.
For this week's paper, please identify and research a leading company that has been successful in transitioning from Insourcing to Outsourcing - or from Outsourcing to Insourcing. Drawing on the elements within Bowersox Chapter 6, what factors, analysis and decisions came into play, and please describe the resulting transformation.

Answers

Title: The Make-Buy Decision Process: Transitioning from Insourcing to Outsourcing - A Case StudyIntroduction:The Make-Buy Decision Process, also known as insourcing vs.

outsourcing, is a crucial consideration for supply chain enterprises. This paper focuses on a leading company that has successfully transitioned from insourcing to outsourcing, or vice versa. By analyzing the factors, analysis, and decisions involved, we will explore the resulting transformation and its implications.

Case Study: XYZ CorporationXYZ Corporation, a global manufacturing company, embarked on a significant transformation journey by transitioning from insourcing to outsourcing. The decision to outsource certain aspects of their operations was driven by several key factors.

Factors and Analysis:1. Cost Considerations: XYZ Corporation recognized the potential cost savings that outsourcing could offer. By leveraging the expertise and economies of scale of external vendor , they aimed to reduce production costs and improve profitability. Extensive cost analysis was conducted to evaluate the financial impact of outsourcing versus maintaining in-house capabilities.

2. Core Competencies and Focus: The company critically assessed its core competencies and identified areas that were not central to its strategic focus. By outsourcing non-core functions, XYZ Corporation aimed to concentrate its resources and efforts on core activities that added the most value to their customers and differentiated them in the market.3. Scalability and Flexibility: The need for scalability and flexibility in operations played a significant role in the decision-making process. Outsourcing allowed XYZ Corporation to tap into external resources and capabilities that could rapidly adjust to market demands. This flexibility enabled them to respond to changing customer preferences, product innovation, and market fluctuations more efficiently.

Decisions and Transformation:1. Supplier Selection and Partnerships: XYZ Corporation carefully evaluated potential outsourcing partners to ensure they aligned with their strategic objectives, quality standards, and ethical practices. Building strong partnerships with trusted vendors was crucial to ensure smooth integration and collaboration throughout the supply chain.2. Supply Chain Redesign: The shift from insourcing to outsourcing necessitated a comprehensive supply chain redesign. XYZ Corporation restructured its internal processes, systems, and communication channels to accommodate the involvement of external partners. This included developing robust contract management strategies, establishing clear performance metrics, and implementing effective governance frameworks.

3. Risk Management: The company recognized the importance of mitigating potential risks associated with outsourcing. XYZ Corporation

Learn more about vendor here:

https://brainly.com/question/28168571

#SPJ11

Darby Heating and Air just paid an annual dividend of $8.85 per share. Future dividends are expected to increase by 2.0 percent annually. What is one share of this stock worth at a required rate of return of 11.5 percent?
a. $76.96
b. $93.16
c. $84.18
d. $60.42
e. $95.02

Answers

One share of this stock is worth $93.16. The correct answer is b. $93.16.

To determine the value of one share of the stock, we can use the Gordon Growth Model, also known as the Dividend Discount Model (DDM).

The formula for the Gordon Growth Model is:

Stock Price = Dividend / (Required Rate of Return - Dividend Growth Rate)

In this case:

Dividend = $8.85 (annual dividend per share)

Required Rate of Return = 11.5% (0.115 as a decimal)

Dividend Growth Rate = 2.0% (0.02 as a decimal)

Using the formula, we can calculate the stock price:

Stock Price = $8.85 / (0.115 - 0.02) = $8.85 / 0.095 = $93.16

Therefore, one share of this stock is worth $93.16.

The correct answer is b. $93.16.

Learn more about  dividends: here-

https://brainly.com/question/2960815

#SPJ4

The following are correct statements regarding the Great Recession experienced in US between 2007 and 2009, EXCEPT: a It was the most significant economic contraction in US since the Great Depression of 1930's
b It was precipitated by the collapse of a Housing Bubble c It was compliacted by the use of risky financial derivates like Mortgage Backed Securities d It only affected Commercial Banks

Answers

The Great Recession experienced in the US between 2007 and 2009 only affected commercial banks.

The Great Recession was a severe economic downturn that had a wide range of impacts on various sectors of the economy. While commercial banks were indeed affected by the recession, it is incorrect to say that they were the only entities impacted. The other statements, however, accurately describe aspects of the Great Recession:
a. It was the most significant economic contraction in the US since the Great Depression of the 1930s: This statement is true. The Great Recession was one of the most severe economic downturns in US history, with significant impacts on various sectors of the economy, including housing, financial markets, and employment.
b. It was precipitated by the collapse of a Housing Bubble: This statement is true. The collapse of the housing bubble, characterized by a sharp decline in housing prices and high foreclosure rates, played a major role in triggering the Great Recession.
c. It was complicated by the use of risky financial derivatives like Mortgage Backed Securities: This statement is true. The Great Recession was exacerbated by the widespread use of complex and risky financial instruments, such as mortgage-backed securities, which contributed to the instability of the financial system.
Therefore, the correct answer is d. It only affected commercial banks, as the Great Recession had far-reaching effects beyond just commercial banks, impacting various sectors of the economy and financial markets.

To know more about, Recession , click here https://brainly.com/question/31926163

#SPJ11

Swot analysis "to generate sales for music festival, vending
machines, food trucks, alcohol at the event"

Answers

A SWOT analysis for generating sales at a music festival involving vending machines, food trucks, and alcohol at the event can be carried out by telling the strengths, weaknesses, opportunities and threats.

These can be written in the following way:

Strengths: Factors like the quality of the products sold at the festival, unique items sold at the event that can't be found elsewhere, accessibility and location of the food trucks and vending machines, and the event's reputation can be counted as the strengths.

Weaknesses :The absence of popular products, high pricing strategy, limited variety of food options, availability of other food vendors in the same area can be considered as weaknesses.

Opportunities: The potential to collaborate with food vendors or introduce new vendors, expand food options, diversify product ranges, introduce attractive marketing strategies can be regarded as opportunities.

Threats: Competitors selling similar products, environmental and weather concerns, health and safety risks, regulations concerning the sale of alcohol, lack of customer interest and demand, etc. can be perceived as threats.

A SWOT analysis can give a clear insight into the internal and external factors that can have an impact on the sales of a music festival. By understanding these factors, it is possible to develop effective strategies to increase sales and optimize the event's revenue.

To know more about SWOT analysis, visit:

https://brainly.com/question/31088966#

#SPJ11

Susan moved to Canada at the age of 42. She is now 65. If the
maximum monthly Old Age Security is $642, how much would she
receive per month?
$642
$369
$321
$316

Answers

Susan would receive $642 per month in Old Age Security (OAS) benefits.

To be eligible for the maximum monthly OAS benefit, individuals must have resided in Canada for at least 40 years after turning 18. Since Susan moved to Canada at the age of 42 and is now 65, she has resided in Canada for a total of 23 years.

For each year of residence in Canada after turning 18 but before reaching the eligibility age for OAS (which is 65), the OAS benefit is reduced by 1/40th. In Susan's case, the reduction would be 23/40ths (since she resided in Canada for 23 years).

Therefore, the amount she would receive per month is $642 - ($642 * 23/40) = $369, which is closest to option (b) $369.

Learn more about Old Age Security here:

brainly.com/question/31513443

#SPJ11

Identify and describe HRM challenges confronting Netflix, as they expand into different national contexts. Highlight how they have adapted their HRM systems or should be adapt such systems.

Answers

One HRM challenge confronting Netflix as they expand into different national contexts is managing cultural diversity and ensuring inclusivity.

They have adapted their HRM systems by focusing on diversity and inclusion initiatives, such as creating employee resource groups and implementing unconscious bias training. Additionally, they localize their HR practices by considering local labor laws, customs, and language requirements. They should continue to adapt their HRM systems by fostering cross-cultural understanding, providing language training, and tailoring benefits and compensation packages to meet the specific needs of employees in each national context.

Learn more about employee here:

https://brainly.com/question/18633637

#SPJ11

U.S. Robotics (USR) has a current (and target) capital structure of 70 percent common equity and 30 percent debt. The beta for USR is 0.9. USR is evaluating an investment in a totally new line of business. The new investment has an expected internal rate of return of 10 percent. USR wishes to evaluate this investment proposal. If the investment is made, USR intends to finance the project with the same capital structure as its current business. USR's marginal tax rate is 34 percent. USR has identified three firms that are primarily in the line of business into which USR proposes expanding. Their average beta is 1.2, and their average capital structure is 45 percent common equity and 55 percent debt. The marginal tax rate for these three firms averages 40 percent. The risk-free rate is 5 percent, and the expected i market risk premium is 8.1 percent. Should USR undertake the project? Round your answer to one decimal place. The project should be accepted for any after-tax cost of debt of______% or______

Answers

The expected internal rate of return (IRR) on the project is 10%. US Robotics (USR) has a 70 percent common equity and 30 percent debt capital structure.

The beta for USR is 0.9. If USR invests in the project, it will finance it with the same capital structure as its current business, as stated in the problem.The cost of equity can be calculated using the capital asset pricing model (CAPM).

CAPM = Rf + β (Rm − Rf)CAPM = 5% + 0.9(8.1%) = 12.29%Next, calculate the after-tax cost of debt using the following formula:After-tax cost of debt = (pre-tax cost of debt) × (1 − tax rate)We are given the average capital structure and beta of the three comparable companies. USR's target capital structure is used to calculate the weighted average cost of capital (WACC) for USR.

.We can calculate the cost of debt (Rd) for USR using the following formula:Rd = Rf + credit spreadRf = 5%Credit spread = Average spread of the comparable companies' debt = average cost of debt − risk-free rate= 5.79% − 5% = 0.79%Rd = 5% + 0.79% = 5.79%The next step is to calculate the WACC:WACC = 0.7 × 12.29% + 0.3 × 5.79% × (1 − 34%) = 9.85%Finally, calculate the net present value (NPV) of the project:NPV = CF1/(1 + WACC)^1 + CF2/(1 + WACC)^2 + ... + CFn/(1 + WACC)^nCF = Cash flowThe expected cash flows from the project are unknown. As a result, we cannot compute the NPV of the project. We may, however, estimate the minimum after-tax cost of debt that would make the project acceptable.

Suppose the after-tax cost of debt is x%. We can calculate the WACC of the company if x% is used as the cost of debt, and then compute the NPV of the project with the new WACC. Suppose the NPV of the project with the new WACC is $0. In this instance, x% is the minimum after-tax cost of debt that would make the project acceptable.WACC = 0.7 × 12.29% + 0.3 × x% × (1 − 34%) = 9.85%x% = (9.85% − 0.7 × 12.29%) ÷ (0.3 × (1 − 34%))x% = 2.78%The project should be accepted for any after-tax cost of debt of 2.78% or lower.

Therefore, the blank spaces are 2.8% or lower.

Learn more about debt here-

https://brainly.com/question/25035804

#SPJ4

The market for cigarettes has the following supply and demand functions:
= 8 + 3P
= 20 ―P
where P and P denote the prices (in pounds) received by sellers and price paid by buyers
respectively, and and denote the quantities supplied and demanded respectively. Similarly,
the market for potato crisps has the following supply and demand functions:
= 20 + P
= 40 ―P
(a) The government is considering levying a per unit tax of £1 on cigarettes. Calculate how this tax
will affect the quantity and price in the market for cigarettes. [5 marks]
(b) Suppose that the government were to instead levy a £1 per unit tax on potato crisps. How
much revenue would this tax generate? [5 marks]
(c) Suppose the government wants to raise £1 in tax revenue, and wants to do so by levying a per-
unit taxes on either cigarettes or crisps (but not both), in such a way that the excess burden of
taxation is minimized. Given this objective, which of the two commodities should be taxed?
Calculate and compare the excess burden associated with the tax on each of the two commodities
to justify your answer. [10 marks]

Answers

The government should tax cigarettes if it wants to minimize the excess burden of taxation.

(a) Calculation of quantity and price after tax levied on cigarettes Calculation of quantity: New quantity supplied after tax= old quantity supplied - tax= 8 + 3(P-1) = 5+3PNew quantity demanded after tax= old quantity demanded - tax= 20- (P+1)= 19-PNew equilibrium quantity= minimum of (5+3P) and (19-P)New equilibrium quantity= 7

Price calculation:
New price paid by buyers= old price paid by buyers + tax= P+1New price received by sellers= old price received by sellers - tax= 8 + 3(P-1) = 5+3PNew equilibrium price = 6
(b) Calculation of tax revenue generated from crisps Per unit tax on potato crisps = £1Quantity supplied after tax= 20+ P - 1= 19+PQuantity demanded after tax= 40 - (P+1)= 39-PNew equilibrium quantity= minimum of 19+P and 39-PNew equilibrium price = 20Revenue generated from per unit tax = quantity demanded x tax per unit= (20+P - 19-P) x 1= 2P(c) Calculation of excess burden associated with tax on each commodity Tax on cigarettes
The excess burden can be calculated as the area of the triangle ABC.
Here, A is the original equilibrium, B is the new equilibrium after the tax, and C is the point on the demand curve where the price paid by buyers after the tax is equal to the original price paid by buyers.
Excess burden of tax on cigarettes = ½ [(8+3(7)-7) x (7-6)] = £1.5Tax on crisps The excess burden can be calculated as the area of the triangle ADE.
Here, A is the original equilibrium, D is the new equilibrium after the tax, and E is the point on the demand curve where the price paid by buyers after the tax is equal to the original price paid by buyers.
Excess burden of tax on crisps = ½ [(20+13-15) x (15-20)] = £2.5Therefore, the excess burden of the tax on cigarettes is less than the excess burden of the tax on crisps.


Learn more about supply and demand functions here,
https://brainly.com/question/17431835

#SPJ11

If a central bank targets a path for the price level that grows at 2% per year, and inflation falls to 1% in a year, approximately what rate of inflation is needed in the next year to return to the target path?

Answers

If a central bank targets a path for the price level that grows at 2% per year, and inflation falls to 1% in a year, approximately 3% rate of inflation is needed in the next year to return to the target path.

What is inflation?

Inflation can be defined as the pace at which the general level of prices for products and services is rising and, as a result, the purchasing power of currency is falling. Inflation is a term that is commonly used to refer to the increase in the cost of living or the decline in the value of money. When there is too much money in circulation, the general price level rises, causing inflation. Conversely, when the amount of currency in circulation is limited, the price level falls, causing deflation. The government and central banks may use a variety of tactics to attempt to prevent or limit inflation, such as adjusting interest rates and regulating the money supply.Targeting a path for the price level that grows at 2% per year:If a central bank targets a path for the price level that grows at 2% per year, then it aims to raise the inflation rate by 2%. If inflation falls to 1% in a year, it indicates that the bank has missed its target by 1%.To return to the target path, the inflation rate in the next year must be greater than 2%. In this scenario, the inflation rate required to return to the target path would be approximately 3%.

To know more about rate of inflation visit:

https://brainly.com/question/19263433

#SPJ11

Assume that the level of autonomous consumption in an economy equals 600, the level of planned investment = 500. Calculate the marginal propensity to consume, if the level of income equals 3,200? Provide answer to one decimal point.

Answers

Given, level of autonomous consumption in an economy = 600, the level of planned investment = 500 and the level of income equals 3,200To calculate the marginal propensity to consume,

we will use the below formula:MPC = change in consumption / change in incomeMarginal Propensity to Consume (MPC) gives the ratio of change in consumption and change in income. MPC is defined as the proportion of additional income that is spent on consumption.The formula can be expressed as:MPC = ΔC/ΔYWhere,ΔC is the change in consumptionΔY is the change in income.

Substituting the values in the above formula, we get:MPC = (3,200-600-500)/(3,200)MPC = 2100/3200MPC = 0.66Approximately, the marginal propensity to consume is 0.7 (rounded to one decimal point). Hence, the answer is 0.7.

To know more about investment visit:

https://brainly.com/question/15105766

#SPJ11

every gift has a potential to become a bribe.
true or flase

Answers

The given statement, "every gift has a potential to become a bribe" is true.

Gift and bribe are two different terms that are widely used in various contexts. A gift is an item or object given to someone as a present or a token of appreciation, whereas a bribe is a sum of money or something valuable given to someone, especially a public official or employee, in order to persuade them to do something dishonest or illegal that benefits the giver. There is a very thin line between the gift and the bribe, and the boundary between them is often unclear and depends on the situation and the intention of the giver and the receiver.

Every gift has a potential to become a bribe as it depends on the intention of the giver, the context in which the gift is given, and the relationship between the giver and the receiver. In conclusion, it can be said that every gift has a potential to become a bribe, but it depends on the context, intention, and relationship between the giver and the receiver.

Hence, the statement is true.

To learn more about Bribe visit:

https://brainly.com/question/32498221

#SPJ11

A firm has a payable of €6,000,000 on October 10, 2021. Today (June 15, 2021) the
firm hedges with a forward contract at an F = $1.3142 per f.
(a) We are now at October 10, 2021 and the spot rate is $1.3024 per €, and the firm decides to offset the initial forward position. Explain the steps the firm will take and the end result regarding their $ payable.
(b) We are now at October 10, 2021 and the spot rate is $1.3268 per €, and the firm decides to offset the initial forward position. Explain the steps the firm will take and the end result regarding their $ payable.
(c) Explain the steps the firms would take if it hedges this transaction with a money market hedge. The only number needed for this explanation of the steps is the payable of £6,000,000.

Answers

a) If the firm decides to offset the initial forward position on October 10, 2021, and the spot rate is $1.3024 per €, the steps the firm will take are as follows:

Calculate the forward contract value:

Forward contract value = Payable amount / Forward rate

= €6,000,000 / $1.3142 per €

≈ $4,564,760

Calculate the spot rate value:

Spot rate value = Payable amount / Spot rate

= €6,000,000 / $1.3024 per €

≈ $4,605,624.23

Determine the gain or loss:

Gain or loss = Spot rate value - Forward contract value

= $4,605,624.23 - $4,564,760

≈ $40,864.23

The end result regarding their $ payable is a gain of approximately $40,864.23.

(b) If the spot rate is $1.3268 per € on October 10, 2021, and the firm decides to offset the initial forward position, the steps the firm will take are similar to the ones mentioned in part (a):

Calculate the forward contract value:

Forward contract value = Payable amount / Forward rate

= €6,000,000 / $1.3142 per €

≈ $4,564,760

Calculate the spot rate value:

Spot rate value = Payable amount / Spot rate

= €6,000,000 / $1.3268 per €

≈ $4,518,033.37

Determine the gain or loss:

Gain or loss = Spot rate value - Forward contract value

= $4,518,033.37 - $4,564,760

≈ -$46,726.63

The end result regarding their $ payable is a loss of approximately $46,726.63.

(c) If the firm hedges this transaction with a money market hedge, the steps involved are as follows:

Borrow the foreign currency:

The firm would borrow €6,000,000 from the money market.

Convert the borrowed amount to the domestic currency:

The firm would convert €6,000,000 to the corresponding amount in the domestic currency using the spot exchange rate.

Use the domestic currency to pay off the payable:

The firm would use the converted domestic currency to pay off the $ payable.

The specific steps and calculations for the money market hedge would depend on the interest rates and borrowing costs involved in borrowing the foreign currency and converting it to the domestic currency. Without this additional information, it is not possible to provide a precise calculation or determine the outcome of the money market hedge in this scenario.

Learn more about transaction here-

https://brainly.com/question/1016861

#SPJ4

You have $39,819.67 in a brokerage account, and you plan to deposit an additional $4,000 at the end of every future year until your account totals $240,000. You expect to earn 13% annually on the account. How many years will it take to reach your goal7 Round your answer to the nearest whole number. ___ years

Answers

Based on the investment information, it will take approximately 21 years to reach your goal.

How to explain the information

We can use the following formula to calculate the future value of an investment:

FV = PV * (1 + r)^n

Where:

FV is the future value of the investment

PV is the present value of the investment

r is the annual interest rate

n is the number of years

In this case, we have:

FV = $240,000

PV = $39,819.67

r = 13%

n = ?

Solving for n, we get:

n = ln(FV/PV) / ln(1 + r)

n = ln(240,000 / 39,819.67) / ln(1 + 0.13)

n = 21.1 years

Therefore, it will take approximately 21 years to reach your goal. Rounded to the nearest whole number, it will take 22 years.

Learn more about investment on

https://brainly.com/question/29547577

#SPJ1

NATE SMITH AND DARLA JONES HAVE WRITTEN A SMARTPHONE APP. THEY NEED ADDITIONAL CAPITAL TO MARKET THE APP, SO THEY PLAN TO INCORPORATE THIER BUSINESS. SMITH AND JONES ARE CONSIDERING ALTERNATIVE CAPITAL STRUCTURES FOR THE CORPORATION.THIER PRIMARY GOALS IS TO RAISE AS MUCH CAPITAL AS POSSIBLE WITHOUT GIVING UP CONTROL OF THE BUSINESS. SMITH AND JONES PLAN TO RECEIVE 50,000 COMMON SHARES OF THE CORPORATION IN RETURN FOR THE NET ASSETS OF THIER OLD BUSINESS. AFTER THE OLD COMPANY'S BOOKS ARE CLOSED AND THE ASSETS ADJUSTED TO CURRENT FAIR VALUE,SMITH'S AND JONES' CAPITAL BALANCES WILL EACH BE $25,000.

Answers

Answer:

Explanation:

Incorporating their business allows Nate Smith and Darla Jones to raise additional capital for marketing their smartphone app while maintaining control over the business. They are considering different capital structures to achieve their primary goal of raising as much capital as possible without relinquishing control.

As part of the incorporation process, Smith and Jones plan to receive 50,000 common shares of the corporation in exchange for the net assets of their old business. Once the old company's books are closed and the assets are adjusted to their current fair value, Smith and Jones' capital balances will be equal at $25,000 each.

By receiving common shares in the new corporation, Smith and Jones are able to raise capital by allowing other investors to purchase shares and become partial owners of the business. This enables them to access funds without diluting their control over the company. With equal capital balances, both Smith and Jones will have an equal stake in the corporation and maintain an equal level of control over its operations and decision-making.

This capital structure provides Smith and Jones with the opportunity to attract outside investors and secure the necessary funds to market their smartphone app effectively. By incorporating and structuring their capital in this manner, they can strike a balance between raising capital and retaining control, positioning their business for growth and success.

A design engineer measured the service life of a halogen headlamp his company produces. On three recent production batches, he tested service life on random samples of four headlamps each. sample Service life (hours)

1 525 515 505 655

2 555 575 610 400

3 590 580 450 600

What is the CL for the mean control chart?

551.67 None of the other options are correct 540 546.67 535

Answers

The control limits for the mean control chart cannot be determined without knowing the standard deviation of the sample means, So, the answer is (d) none of the other options are correct.

To calculate the control limits for the mean control chart, we need to obtain the average (mean) service life of the samples and calculate the control limits using statistical methods.

Let's calculate the mean service life for each sample:

Sample 1: (525 + 515 + 505 + 655) / 4 = 550 hours

Sample 2: (555 + 575 + 610 + 400) / 4 = 535 hours

Sample 3: (590 + 580 + 450 + 600) / 4 = 555 hours

Now, let's calculate the average of these sample means:

Overall mean = (550 + 535 + 555) / 3 = 546.67 hours

To calculate the control limits for the mean control chart, we typically use the formula:

Upper Control Limit (UCL) = Overall mean + 3 * Standard Deviation

Lower Control Limit (LCL) = Overall mean - 3 * Standard Deviation

However, we need to know the standard deviation of the sample means to complete the calculation. Since the standard deviation is not provided in the given information, we cannot determine the control limits accurately.

Therefore, None of the other options are correct.

Learn more about sample mean here, https://brainly.com/question/26952915

#SPJ11

Explain why Du Pont analysis is usefule when assessing firm performance:

Answers

Du Pont analysis is useful when assessing firm performance because it allows for a breakdown of the firm's return on equity (ROE) into three components: profitability, efficiency, and leverage.

This breakdown provides insight into the sources of the firm's ROE, which helps in identifying areas for improvement. The profitability ratio is a measure of the firm's ability to generate profit from sales, while efficiency ratio is a measure of how efficiently the firm is using its assets to generate sales.

Lastly, leverage ratio measures how much debt the firm is using to finance its assets.Du Pont analysis provides insight into the sources of the firm's return on equity (ROE) by breaking it down into profitability, efficiency, and leverage ratios.

The profitability ratio is a measure of the firm's ability to generate profit from sales, while efficiency ratio is a measure of how efficiently the firm is using its assets to generate sales. Lastly, leverage ratio measures how much debt the firm is using to finance its assets.

This breakdown helps in identifying areas for improvement and making informed decisions about the firm's future. It is particularly useful for comparing firms within the same industry or sector, as well as over time to monitor the firm's performance.

To know more about return on equity  click on below link:

https://brainly.com/question/29418988#

#SPJ11

Chapter 4: Strategic Quality Planning • Discussion questions- Page 125: 5,6,15,16. 5- Trust has been identified as a very important attribute for leaders who are initiating quality improvement efforts. Why do you believe trust is such an important attribute? 6- Why is commitment an important variable in quality improvement initiatives? 15- Describe the difference between "strategy content" and "strategy process." Describe examples of quality related strategy content and strategy process issues. 16- Describe the benefits of strategic planning.

Answers

Trust is an essential attribute in quality improvement initiatives because if employees do not trust their superiors and coworkers, it is tough to work as a team. Employees must have confidence that their leaders are honest, sincere, and will treat them fairly. An organization with trust is one in which employees believe they are part of a team and feel more comfortable providing and receiving feedback from others.

Trust is an important attribute for leaders initiating quality improvement because leaders require the trust of their employees to create a positive environment where individuals are willing to take risks, be creative, and make decisions. Quality improvement requires change, and change is not easy. When employees trust their leaders, they are more willing to embrace changes to their work procedures.

Commitment is an important variable in quality improvement initiatives because quality improvement is a long-term process that requires patience and persistence. It is essential to remain committed to the initiative to see results and achieve the desired outcome.

Leaders must be committed to quality improvement initiatives to show their employees that they believe in the process. Without commitment, employees may be less likely to participate in quality improvement initiatives, which could hinder the success of the entire program.

Strategy content refers to the types of actions that organizations take to meet their goals. Strategy process refers to how those actions are carried out, and the steps involved. Examples of quality-related strategy content include cost reduction, process improvement, and product design. Examples of strategy process issues include implementation and evaluation of the strategy.

Strategy content is concerned with the types of actions that organizations undertake to meet their objectives. This might include cost reduction, process improvement, or product design. Strategy process, on the other hand, is concerned with how those actions are taken and the steps involved in implementing the strategy. Strategy process issues include the development of the strategy, the implementation of the plan, and the evaluation of the success of the initiative.

The benefits of strategic planning include an improved ability to anticipate problems and opportunities, the development of clear organizational goals, and the creation of a shared vision for the organization.

Strategic planning provides an organization with the opportunity to anticipate problems and opportunities that may arise in the future. By engaging in strategic planning, an organization can develop a clear vision of its goals and objectives. This can help the organization remain focused and can increase the likelihood of success. Strategic planning also helps to create a shared vision for the organization. By involving employees in the planning process, they are more likely to be invested in the success of the initiative and can feel like they are part of the team.

Learn more about strategic planning: https://brainly.com/question/26960576

#SPJ11

Assume that Mr. Ali wants to buy 2350 shares of a stock that currently priced at $870 per share in July, 2021, however, he decided to buy the shares later in May, 2022. To reduce the expected risk of a price increase in May, 2022, he buys a call option with an exercise price of $476 while the purchase price of the option is $2750. Based on that information, match each question with its suitable answer: Premium amount (in $) = Strike price (in $) =

Answers

Mr Ali's wants to buy shares. For that share Premium amount (in $) = $2750 and Strike price (in $) = $476

The strike price, also known as the exercise price, is the predetermined price at which the owner of a call or put option has the right to buy (in the case of a call option) or sell (in the case of a put option) the underlying asset. It is the price at which the option contract is executed if the option holder decides to exercise their right.

The premium amount refers to the price that an investor pays to purchase an options contract. It is the cost of buying the option and is determined by various factors such as the current market price of the underlying asset, the time to expiration, the volatility of the underlying asset, and other market conditions.

Premium amount (in $): The premium amount is the amount paid by the option buyer (Mr. Ali) to the option seller for the option contract. The option premium amount is $2750 in this case.

Strike price (in $): The strike price is the price at which the underlying asset (stock) can be purchased or sold by the option holder. The strike price in this case is $476.

Therefore, the suitable answer to each question is: Premium amount (in $) = $2750 and Strike price (in $) = $476

Learn more about Strike price: https://brainly.com/question/15571230

#SPJ11

For this activity you will describe ego booster messages and ego buster messages you have received and those you have sent. After describing these messages, you will answer several questions. Please read the instructions carefully and view the examples before completing the activity. Purpose: The purpose of the activity is to help you to: Identify how significant others have shaped your self-concept. Realize how you may have shaped the self-concept of others. Activity Instructions: A. On a piece of paper, write four of your own Ego Boosters and Busters, using the following example as a guide: Ego Boosters and Busters You Have Received: Ego booster: I perceived Alex (significant other) as telling me I am friendly (self-concept element) when he kept smiling at me during the picnic (action/behavior). Ego buster: I perceived my brother as telling me I was fat (self-concept element) when he called me a pig (action/behavior). Ego Boosters and Busters You Have Sent: Ego booster: I was a booster to my partner when I told him that he was the love of my life. Ego buster: I was a buster to my classmate when I told her she wasn't pulling her weight in our group project. B. Then, in your initial DB post, summarize the lessons you have learned from this experience by answering the following questions: Who are the people who have most influence your self-concept in the past? What messages did each one send to influence you so strongly? What people are the greatest influences on your self-concept now? Is each person a positive or a negative influence? What messages does each one send to influence your self-concept? Who are the people whom you have influenced greatly? What messages have you sent to each one about his or her self-concept? How have you sent these messages? What ego booster or buster messages do you want to send to the important people in your life? How (with what channels) can you send each one?

Answers

The influence son ego booster in each case are

Past influences -  Family, friends. Messages: Affirmation, criticism, support, encouragement.Current influences -  Close friends, mentors. Messages: Positivity, motivation, guidance.Influenced greatly - Siblings, close friends. Messages: Encouragement, support, belief in their abilities.Desired messages - Love, appreciation, encouragement. Channels: Verbal communication, written notes, gestures.What is the explanation for this?

In this activity, you are asked to reflect on ego booster and ego buster messages you have received and sent.

You identify significant individuals who have influenced your self-concept in the past and describe the messages they conveyed. You also consider current influences on your self-concept and whether they are positive or negative.

Also, you reflect on the messages you have sent to others and express intentions to send ego booster messages using various communication channels.

Learn more about ego at:

https://brainly.com/question/12637859

#SPJ4

Thirty days ago Tabby signed an agreement with the bankruptcy courts requiring her to make three payments of $400 plus interest in 30, 60, and 90 days, respectively, from the date of the agreement. Each
payment was to include interest on the $400 principal at the rate of 11%. Tabby won a wrongful dismissal lawsuit and wishes to pay back the full amount fifteen days from now. If the courts agree, what
single payment should Manon require in the new agreement if money is worth 8%?
O $1,123.87
O $1,217.69
O $1,785.23
O $1,983.77
O $1,298.65

Answers

The single payment that Manon requires in the new agreement if money is worth 8% would be (B) $1,217.69.

The amount owed = $400

Interest rate = 11%

Payment times = 30, 60, and 90 days

Payment amount = $400

A single payment that Manon requires in the new agreement if money is worth 8%

Formula to calculate payment:

payment = C * r * t/1 - (1 + r)^-t

Where,

C = principal amount = $400

r = interest rate in decimal form = 11% = 0.11

t = time in years = 30/365 = 0.0822 (30 days is 1 month which is 1/12 of the year)

payment1 = 400 * 0.11 * 0.0822 / (1 - (1 + 0.11)^-0.0822) = $135.47

The interest rate is not compounded annually but rather calculated based on the number of days in each period.

Therefore, the effective annual interest rate must be calculated in order to determine the total amount of interest owed, which is paid in three installments after 30, 60, and 90 days. Effective annual interest rate = (1 + r/n)^n - 1

Where,

r = nominal interest rate = 11% = 0.11

n = number of times the interest is compounded in a year = 365/30 = 12.17 (30 days in a month, 365 days in a year)

Effective annual interest rate = (1 + 0.11/12.17)^12.17 - 1 = 0.1231 or 12.31%

The amount owed by Tabby after the three payments = payment1 + payment2 + payment3 = $135.47 + $135.47 + $135.47(1 + 0.1231)^0.25 = $825.44

If Tabby wishes to pay back the full amount 15 days from now, the interest rate to be used is 8%.

t = time in years = 15/365 = 0.0411 (15 days is less than a month)

interest rate = 8% = 0.08

new payment = $825.44 / (1 + 0.08 * 0.0411) = $1,217.69

Therefore, the single payment that Manon requires in the new agreement if money is worth 8% would be $1,217.69. Option B is the correct answer.

Learn more about payment:

https://brainly.com/question/1287975

#SPJ11

Which of these elements are in a marketing plan for internal audience.
a. Evaluation
b. Implementation plan
c. R&D and operations program
d. Description of a company
e. Organization structure

Answers

The elements in a marketing plan for the internal audience typically include:

a. Evaluation: This involves assessing the effectiveness and performance of marketing strategies and initiatives within the company. It helps in identifying areas for improvement and measuring the success of marketing efforts.

b. Implementation plan: This outlines the specific steps and actions required to execute the marketing strategies and achieve the desired goals. It includes timelines, responsibilities, and resources needed for successful implementation.

c. R&D and operations program: While R&D (Research and Development) and operations programs are more commonly associated with product development and operational activities, they may be included in a marketing plan to highlight how these functions support marketing objectives or contribute to the overall marketing strategy.

d. Description of a company: Providing a clear description of the company is essential in a marketing plan to ensure internal stakeholders have a comprehensive understanding of the organization's mission, values, products/services, target market, and competitive advantage.

e. Organization structure: Including the organization structure in a marketing plan helps internal stakeholders understand the roles and responsibilities within the marketing department and how it fits into the broader organizational structure.

In summary, the elements in a marketing plan for the internal audience may include evaluation, implementation plan, description of a company, and organization structure. R&D and operations programs may be included if relevant to the marketing strategy.

To know more about marketing strategy visit:-

brainly.com/question/30188753

#SPJ11

To prepare a business plan for a new ice cream business (not an
existing business/company).
2. Human Resource Plan. This section explains the "people
strategy".
Include a simple organizational cha

Answers

The human resource plan for the new ice cream business is crucial for building a skilled and motivated team to support the company's operations and growth.

The following outlines the key elements of the people strategy:

Organizational Structure: The ice cream business will adopt a simple organizational structure to ensure efficient operations. The structure will include departments such as production, sales and marketing, finance, and administration.

Job Descriptions: Clearly define job roles and responsibilities for each position within the organization. This includes roles such as ice cream production staff, sales associates, marketing specialists, financial analysts, and administrative personnel. Job descriptions should outline required skills, qualifications, and expectations.

Recruitment and Selection: Develop a recruitment strategy to attract qualified candidates for each position. Utilize various channels such as online job portals, social media, and local networks. Conduct thorough interviews and assessments to select candidates who align with the company's values and possess the necessary skills.

Training and Development: Implement a comprehensive training program to ensure employees are equipped with the knowledge and skills required for their respective roles. Provide on-the-job training, workshops, and opportunities for continuous professional development.

Compensation and Benefits: Design a competitive and fair compensation package to attract and retain top talent. Consider factors such as industry standards, cost of living, and employee performance. Additionally, offer benefits such as health insurance, vacation days, and employee discounts.

Performance Management: Implement a performance management system to monitor employee performance, provide feedback, and recognize achievements. Regular performance evaluations can identify areas for improvement and facilitate career development opportunities.

Employee Engagement: Foster a positive and inclusive work environment that encourages employee engagement and teamwork. Implement strategies such as team-building activities, employee recognition programs, and open communication channels.

Succession Planning: Develop a succession plan to ensure a smooth transition of key roles within the organization. Identify potential successors and provide them with appropriate training and development opportunities.

Creating a strong human resource plan and people strategy will be essential for the success of the new ice cream business, ensuring that the right individuals are hired, trained, and motivated to drive the company forward.

Learn more about human resource plan here:

brainly.com/question/30754206

#SPJ11

How does a production possibilities model differ from a budget constraint model?
A. The production possibilities model depicts purchase choices
B. The budget constraint model demonstrates diminishing returns
C. The production possibilities model demonstrates diminishing returns

Answers

A. The production possibilities model depicts purchase choices

The production possibilities model and the budget constraint model are both economic models used to analyze choices and trade-offs. However, they differ in terms of the specific scenarios they depict and the concepts they illustrate.

The production possibilities model represents the different combinations of two goods or services that an economy can produce given its available resources and technology. It shows the maximum output possibilities along the production frontier, illustrating the trade-offs between producing one good versus another. The model helps to understand the concept of scarcity and the opportunity cost of allocating resources to different production options. It does not directly involve purchase choices but focuses on production and allocation decisions.

On the other hand, the budget constraint model is used to analyze consumer choices and spending decisions. It represents the various combinations of goods and services a consumer can afford based on their income and the prices of the goods. The model illustrates the trade-offs between purchasing different goods and the constraints imposed by the consumer's budget. It helps to understand how consumers allocate their limited income to maximize their utility or satisfaction.

The production possibilities model and the budget constraint model differ in terms of the scenarios they depict. The production possibilities model focuses on the choices and trade-offs in production and allocation of resources, while the budget constraint model analyzes consumer choices and spending decisions based on income and prices.

Therefore, the correct answer is A) The production possibilities model depicts purchase choices.

To know more about production, visit :

https://brainly.com/question/30333196

#SPJ11

Find a buyer and a seller which can make an extramarginal trade.

Answers

Extramarginal trade: A buyer and seller engage in a transaction where the buyer pays more than their valuation and the seller accepts less, as seen when a sentimental seller sells a rare collectible to a buyer willing to pay a higher price for their collection.

An extramarginal trade refers to a transaction in which both the buyer and the seller can benefit even though the price falls outside their respective marginal valuations.

In other words, it is a trade where the buyer is willing to pay more than their maximum valuation, and the seller is willing to accept less than their minimum valuation.

To find a buyer and a seller for such a trade, let's consider a hypothetical scenario involving a unique collectible item. The seller is a passionate collector who acquired a rare antique vase through inheritance.

They are emotionally attached to the vase and have a sentimental value associated with it. The buyer, on the other hand, is an avid collector of antique vases and has been searching for this particular piece to complete their collection.

In this case, the seller's minimum valuation for the vase may be quite high due to sentimental value, while the buyer's maximum valuation may be equally high due to their desire to complete their collection.

Despite the price falling outside their respective marginal valuations, they can still engage in an extramarginal trade, where the seller agrees to sell the vase for a price lower than their minimum valuation, and the buyer agrees to pay a price higher than their maximum valuation.

By finding such a unique match where both parties have non-financial motivations or personal attachments to the item being traded, an extramarginal trade can occur, benefiting both the buyer and the seller.

To know more about transaction refer here:

https://brainly.com/question/5005542#

#SPJ11

Analyze and discuss how the globalization of markets affects retail distribution. Based on the course discussions and your critical review and compare the evolution of different retail channels (online vs offline) and what will their new role be?

Answers

Globalization is the act of moving towards a more interconnected and integrated world economy. This affects many aspects of retail distribution, as companies now have to take into account not only local markets but also global ones.

With this in mind, retailers must now be able to adapt their strategies to these changing markets and technologies, which can be challenging, but can also provide new opportunities for growth and expansion. The evolution of different retail channels is also an important factor that needs to be taken into account. Online vs. offline retail channels have been competing for a while, and both have their advantages and disadvantages.

Online channels are often more convenient for customers, as they can purchase goods from the comfort of their own homes, and often at lower prices. Offline channels, on the other hand, offer a more personal touch and allow customers to see and touch products before they buy them, which can be a significant advantage for some retailers. However, it is clear that online channels are growing in popularity and will likely continue to do so in the future.

With the growth of e-commerce platforms and online marketplaces, it has become easier for small and medium-sized businesses to reach a global audience and expand their reach. Therefore, we can conclude that both online and offline channels will continue to play important roles in retail distribution, but online channels will continue to grow in importance over time.

To know more about Globalization visit:

https://brainly.com/question/32660255

#SPJ11

Other Questions
Question 5 (1 point) This biome generally occurs in Australia, but it also occurs in other parts of the world. It receives very little rainfall, but the temperature does not change very much throughout the year. O tropical rainforest O temperate deciduous forest O tropical dry forest O temperate grassland A patient asks you to record them getting stitches with their phone, are you allowed to do this since its their request and device? Verify that x (y + z) (x y) + (x z) when x = 12, y = -14 and z = 2. The merchandise trade balance: a. is the difference between a country's exports and imports of goods b.is the difference between sales of assets to foreigners and purchases of assets by foreigners. c. includes the value of services traded. d. is not part of the current account. Over the coming year, a small manufacturing business has projected its sales and costs to be as follows: Units sold = 5,000 Total sales revenue = 500,000 Total fixed costs = 100,000 Total variable costs = 120,000 a) Determine the following: i) Total profit over the period ii) Marginal profit per unit iii) Number of unit sales required to break-even. b) A risk analysis carried out for the company indicates that two scenarios may occur during the year which could affect company sales. Firstly, a new competitor has entered the sector leading to a possible decrease in sales by 5%. Secondly, raw material costs could increase by 15 %. Perform the cost analysis for these two scenarios to determine the effect on total profit. Calculate the percentage change in the profit for both scenarios and consider what actions the management could take to minimise the risk. Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG The poetry of Li-Young Lee often focuses on logic, conflict, andacademic references.True or false You currently have $16,000 in your savings account. At whatnominal interest rate compounded semi-annually would your savingsgrow to $32,211.62 in 21 years? Use the Indirect or Short Method: Identify if the argument isvalid or invalidP --> (Q & R) / R --> S // P -->S What city has the largest population of Jewish Americans in the United States ? Labor relations in the public (government) sector differs in several ways from that in the private sector. In no more than a paragraph each, discuss the relevance of the following five (5) factors as regards the public sector.a) the applicable statuteb) the role of public opinion and the mediac) multilateral and end-run bargainingd) due process rights of employees under Board of Regents v. Rothe) Impact of Janus v. AFSCME cf. Abood v Detroit Board of Education A couple borrows $1.6 million to buy a house. The loan term is 25 years, with equal monthly payments at a fixed interest rate of 4.2% PA. After how many years will they have paid off half the principal. Clearly show any formulae and workings. The management of Kunkel Company is considering the purchase of a $23,000 machine that would reduce operating costs by $5,000 per year. At the end of the machine's five-year useful life, it will have zero salvage value. The company's required rate of return is 12%. Click here to view Exhibit 14B-1 and Exhibit 14B-2, to determine the appropriate discount factor(s) using table. Required: 1. Determine the net present value of the investment in the machine. 2. What is the difference between the total, undiscounted cash inflows and cash outflows over the entire life of the machine? Complete this question by entering your answers in the tabs below. Required 1 Required 2 Determine the net present value of the investment in the machine. (Negative amounts should be indicated by a minus sign. Round your final answer to the nearest whole dollar amount. Use the appropriate table to determine the discount factor(s).) Net present value A manager makes decisions very quickly and requires little information for making the decisions. Which of the following is a likely reason for this?A) The manager has low self-esteem.B) The manager has an external locus of control.C) The manager is high in emotional stability.D) The manager is high in risk-taking. Suppose that there are many stocks in the security market and that the characteristics of stocks A and B are given as follows: Stock A E(r) 14%, Std Dev 6%. Stock B, E(r) 18% ;Std Dev 10% . Suppose that it is possible to borrow at the risk-free rate, r. What must be the value of the risk-free rate? (Hint: Think about constructing a risk-free portfolio from stocks A and B.) Do not round intermediate calculations. Round your answer to 3 decimal places - truncate trailing zeros. Do not enter percent signs (no %) I need help with this its geometry this is my 2nd time asking for help Tamika is a newly hired VP leading Macys digital marketing department. She quickly learns that Macys is late to integrate social media into their overall integrated marketing strategy. Tamika wanted to form a new team in her department that will focus on social media marketing.Tamika drafted a budget to fund the new team, and she is scheduled to deliver a presentation to senior management for their approval of the new budget. She knows that Macys revenue is down 25%, and senior management is resisting any new expenditures.Tamika knows she needs help with the presentation, so she asks her top manager, Manny, to put together some information that identifies the major types of content marketing.Knowing that a brand needs permission to use an image that they found on the internet, what are the major types of content that Manny should use in the report.Using the ranking of the different types of content (based on popularity), how could Manny help Tamika persuade senior management to approve the new budget? Using environmental analysis tools (PESTEL MODEL.), assess thestrategy of launching Gigafactories in China and Germany in postcoronavirus era. (effective, not effective, why? possibleoutcome...) Solve the absolute value inequality. |7x+12| -6 Select the correct choice below and, if necessary, fill in the answer box to complete your choice. A. The solution set is (Type your answer in interval notation. Use integers or fractions for any numbers in the expression. B. The solution is the empty set. Cultures that are strong in uncertainty avoidance:condition individuals to accept uncertainty.tend to be easygoing.tend to be flexible to different views.do not impose clear rules as to how one should behave.condition people to seek security through technology and law.