Reading and Discussing an Article about Making a Homemade Voltaic Cell

In the space provided, describe your sketch using terms you have learned in the lesson.​

Answers

Answer 1

Answer: The following should be included in your description

• Zinc is the anode, and copper is the cathode

• The lemon flesh and juice provide the salt bridge and electrolyte solution

• Electrons flow from zinc to copper through the external wires

• Electrolytes flow in the lemon. Positive ions (cations) moved toward copper electrodes (cathodes), and negative ions (anions) move toward zinc electrodes (anodes). These balance the charges building up

• Two cells in series provide more energy output than one. The clock may need more energy than can be supplied by one cell

• Batteries do not need external source of reactants, whereas a fuel cell must be supplied with reactants

Explanation: Edg 2021


Related Questions

Which of the following is a pure substance?
Chlorine B. salt solution C. bronze D. salad dressing

What is the boiling point of pure water?
About 1000 C B. exactly 1000 C C. it varies D. slightly above 1000 C

Which is an example of a chemical change?
Water evaporating B. butter melting C. match burning D. powder being made

Which of these indicate a chemical change?
Color change B. temperature change C. gas-forming D. all of the above

Which of these is an impure substance?
Tap water B. gold C. carbon dioxide D. boron

Answers

Answer:

1. B

2. 100 C

3.  C

4. D

5. D

Explanation:



The
of a chemical reaction is the maximum amount of product that can be produced​

Answers

Answer= Maximum amount of product that could be obtained under ideal conditions from a given amount of reactants.

Explanation:

The theoretical yields is the ideal maximum amount of a product that can be produced during a chemical reaction while the limiting reactant is the reactant that determines the maximum amount of product that can be formed. mitgliedd1 and 61 more users found this answer helpful.

Solve this puzzle
R+R

Answers

The answer is summer (sum R)
Other Questions
if you subtract 17 from my number and multiply the difference by -6 the results is -138 what is Sarah's number Find the volume for the regular pyramid.6 cu. units12 cu. units4 cu. units What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship.