Plz help me! Well mark brainliest if you are correct!

range in thickness from 5,600 to 7,200 ft.
Antarctica's
A. geysers
B. atolls
C. ice sheets
D. mountains

Answers

Answer 1

Answer:

the answer actually is ice sheets

Explanation:


Related Questions

What is the difference between a "police state" and a "policed state" ?

Answers

Answer:

The spelling

:

Police and Policed

so the difference between that two is D

how does colon cancer affect daily life

Answers

Colon cancer affects daily life. A person may feel cramp-like pain in the stomach. The stool may be streaked or mixed with blood. In rectal cancer, the most common symptom is usually bleeding when going to the bathroom.
Explanation:OverviewColon cancer locations Colon cancerOpen pop-up dialog boxColon cancer is a type of cancer that begins in the large intestine (colon). The colon is the final part of the digestive tract.

Colon cancer typically affects older adults, though it can happen at any age. It usually begins as small, noncancerous (benign) clumps of cells called polyps that form on the inside of the colon. Over time some of these polyps can become colon cancers.

Polyps may be small and produce few, if any, symptoms. For this reason, doctors recommend regular screening tests to help prevent colon cancer by identifying and removing polyps before they turn into cancer.

If colon cancer develops, many treatments are available to help control it, including surgery, radiation therapy and drug treatments, such as chemotherapy, targeted therapy and immunotherapy.

Colon cancer is sometimes called colorectal cancer, which is a term that combines colon cancer and rectal cancer, which begins in the rectum.:)

Write a paragraph
explaining how life in the West was different from
life in the East.

Answers

Answer:

Life in the west was different from the life in the east because of people's culture,behavior and actions. Explanation: The difference between the westerners and the people living in the east is mainly the social, cultural and behavioral attitude. Westerners feel less complicated about the life and its rules.

Explanation:

What is the Carolingian Empire also known as?

Answers

Answer: The empire was referred to variously as universum regnum ("the whole kingdom", as opposed to the regional kingdoms), Romanorum sive Francorum imperium ("empire of the Romans and Franks"), Romanum imperium ("Roman empire"), or even imperium christianum ("Christian empire"). Carolingian dynasty. show.

Explanation:

The empire was referred to variously as universum regnum ("the whole kingdom", as opposed to the regional kingdoms)

explain what S.A.L.T. was intended to accomplish

Answers

Answer:

Explanation:

The first agreements, known as SALT I and SALT II, were signed by the United States and the Union of Soviet Socialist Republics in 1972 and 1979, respectively, and were intended to restrain the arms race in strategic ballistic missiles armed with nuclear weapons.

how is the most annoying person in your life(100 points 1st answer get brainiest)

Answers

Answer:

SOOOO ANNOYING. They won't leave me alone at all. I have to pretend that i care. I'm ususally nice but this person is ughh

Explanation:

How did governments around the world respond to the Great Depression?

Answers

Answer:

Some try to stop it and some did not care. Most of the time they would try to do something about it

Explanation:

Who is John Locke and what was his claim to history? Who was the other individual that Locke worked with during the Enlightenment period?

Answers

Answer:

Explanation:

        John Locke, (born August 29, 1632, Wrington, Somerset, England—died October 28, 1704, High Laver, Essex), English philosopher whose works lie at the foundation of modern philosophical empiricism and political liberalism. He was an inspirer of both the European Enlightenment and the Constitution of the United States. His philosophical thinking was close to that of the founders of modern science, especially Robert Boyle, Sir Isaac Newton, and other members of the Royal Society. His political thought was grounded in the notion of a social contract between citizens and in the importance of toleration, especially in matters of religion. Much of what he advocated in the realm of politics was accepted in England after the Glorious Revolution of 1688–89 and in the United States after the country’s declaration of independence in 1776.

Early Years

Locke’s family was sympathetic to Puritanism but remained within the Church of England, a situation that coloured Locke’s later life and thinking. Raised in Pensford, near Bristol, Locke was 10 years old at the start of the English Civil Wars between the monarchy of Charles I and parliamentary forces under the eventual leadership of Oliver Cromwell. Locke’s father, a lawyer, served as a captain in the cavalry of the parliamentarians and saw some limited action. From an early age, one may thus assume, Locke rejected any claim by the king to have a divine right to rule.

After the first Civil War ended in 1646, Locke’s father was able to obtain for his son, who had evidently shown academic ability, a place at Westminster School in distant London. It was to this already famous institution that Locke went in 1647, at age 14. Although the school had been taken over by the new republican government, its headmaster, Richard Busby (himself a distinguished scholar), was a royalist. For four years Locke remained under Busby’s instruction and control (Busby was a strong disciplinarian who much favoured the birch). In January 1649, just half a mile away from Westminster School, Charles was beheaded on the order of Cromwell. The boys were not allowed to attend the execution, though they were undoubtedly well aware of the events taking place nearby.

The curriculum of Westminster centred on Latin, Greek, Hebrew, Arabic, mathematics, and geography. In 1650 Locke was elected a King’s Scholar, an academic honour and financial benefit that enabled him to buy several books, primarily classic texts in Greek and Latin. Although Locke was evidently a good student, he did not enjoy his schooling; in later life he attacked boarding schools for their overemphasis on corporal punishment and for the uncivil behaviour of pupils. In his enormously influential work Some Thoughts Concerning Education (1693), he would argue for the superiority of private tutoring for the education of young gentlemen (see below Other works).

 

Oxford

In the autumn of 1652 Locke, at the comparatively late age of 20, entered Christ Church, the largest of the colleges of the University of Oxford and the seat of the court of Charles I during the Civil Wars. But the royalist days of Oxford were now behind it, and Cromwell’s Puritan followers filled most of the positions. Cromwell himself was chancellor, and John Owen, Cromwell’s former chaplain, was vice-chancellor and dean. Owen and Cromwell were, however, concerned to restore the university to normality as soon as possible, and this they largely succeeded in doing.

Locke later reported that he found the undergraduate curriculum at Oxford dull and unstimulating. It was still largely that of the medieval university, focusing on Aristotle (especially his logic) and largely ignoring important new ideas about the nature and origins of knowledge that had been developed in writings by Francis Bacon (1561–1626), René Descartes (1596–1650), and other natural philosophers. Although their works were not on the official syllabus, Locke was soon reading them. He graduated with a bachelor’s degree in 1656 and a master’s two years later, about which time he was elected a student (the equivalent of fellow) of Christ Church. At Oxford, Locke made contact with some advocates of the new science, including Bishop John Wilkins, the astronomer and architect Christopher Wren, the physicians Thomas Willis and Richard Lower, the physicist Robert Hooke, and, most important of all, the eminent natural philosopher and theologian Robert Boyle. Locke attended classes in iatrochemistry (the early application of chemistry to medicine), and before long he was collaborating with Boyle on important medical research on human blood. Medicine from now on was to play a central role in his life.

do you consider President Andrew Jackson to be a Monarch or a President in a Democracy?

Answers

Answer:

I would say he was a monarch

monarch """"""""""""""""

12.56 rounded to the nearest hundredth? no, its not 12.56

Answers

Answer:

12.6

Explanation:

i dont think u can round it anymore since its already in the hundredths. so it would round up to 12.6 (zero isnt needed) :)

O monarchy
O republic
* democracy
O dictatorship

Answers

Answer:

i need a question to answer this question

Explanation:

How did the Berlin Wall come to represent the struggle of the Cold War? In other words,
explain how East and West, both the city and the ideologies, were reflected in the construc-
tion of the Berlin Wall.

Answers

Answer:

When Ronald Reagan addressed these words to Soviet leader Mikhail Gorbachev in June of 1987, few believed that just two years later the Berlin Wall would actually be dismantled. It seemed like a permanent fixture, symbolizing the irreparable divide between the Cold War powers. But by 1990, all but a few traces of the wall were gone.

Explanation:

I don't think that will help you answer.

Answer is: B. They could be hanged as traitors to their country.

Answers

Answer:

thanks for the points brainliest pls ! thanks btw

Explanation:

Which events led to the reunification of Germany? Check all that apply.
the fall of the Berlin Wall
large strikes led by unions
large protests at religious gatherings
free elections that voted out communist leaders
the collapse of communism in neighboring countries

Answers

Answer:

A, C, E

Explanation:

Don't believe the person ^^^

Answer:

A: the fall of the Berlin Wall.

C: large protests at religious gatherings.

E: the collapse of communism in neighboring countries.

Explanation:

What were changes in historical knowledge based on new discoveries? Choose all answers that are correct. New information about the Trojan Wars came to light when the Iliad was deciphered for the first time in the late 1930s. When King Tut’s tomb was discovered undisturbed in the 1920s, we gained a greater understanding of the Egyptians’ belief in the afterlife. Historians know more about ancient Sumer today than historians did long ago because of archaeological digs over the last two centuries. With the discovery of Pompeii, we learned that life for the upper-class Romans offered comforts and pleasures.

Answers

Answer:

A, B and C

Its correct on da test

What system kept the poor in SC in poverty for generations?

Answers

Answer:

Support programs and policies that promote good health, nutrition and sanitation practices.

Explanation:

Which large planets are composed mostly of hydrogen and helium gases?

rocky planets
steroids
gas giants
dwarf planets

Answers

Answer: A gas giant

Explanation: A gas giant is a large planet composed mostly of gases, such as hydrogen and helium, with a relatively small rocky core. The gas giants of our solar system are Jupiter, Saturn, Uranus and Neptune.

Answer: C. Gas Giants

Explanation:

I hope it helps

By 1968, backlash against a liberal Supreme Court could be
seen in...

A. antiwar demonstrations against the supreme courts holding the constitutionality of the war in vietnam
B. the overturning of the precedent established in Brown v Board of Education
C. congress decision to impeach 3 supreme court judges
D. the 1968 law-and-order campaigns of Richard Nixon and George Wallace

Answers

Answer:

A

Explanation:

Im clutch

What were the differences between the Democrat and Republican Party Platforms in the 1860 election?

Answers

The Republicans wanted to free slaves, Democrats wanted to keep them

Answer:

Democrats wanted to expand slavery while Repulicans did not.

Explanation:

what do you think the Italian people found appealing about fascism​

Answers

Answer:First, it promised a strong, stable government and an end to the political feuding that had paralyzed democracy in Italy. Mussolini projected a sense of power and confidence at a time of disorder and despair. Mussolini's intense nationalism also revived national pride.

Explanation:

20 POINTS!!!!!!!!!!!!!
Paraphrase the following sentences from Chapter 19, paragraph 22:

Once he grabbed the youth by the arm. "Come on, yeh lunkhead!" he roared. "Come on! We'll all git killed if we stay here. We've on'y got t' go across that lot. An' then"--the remainder of his idea disappeared in a blue haze of curses. (Red Badge Of Courage)

Answers

Answer:

Once he took hold of the youth's shoulder. "Come on, you lunkhead!" he exclaimed. "Come on, let's go! If we sit here, we'll all be killed. We just have to cross the area. After that, "—the rest of his thought vanished in a blue cloud of curses.

plz help me with this

Answers

Answer:

Withdraw from the Union, I think

Explanation:

5/6 is equal to 21/ ? ​

Answers

Answer:

si

Explanation:

Answer:

The answer to your question is: 5/6 is equivalent to 21/105

Explanation:

I hope this helps and pls mark me brainliest :)

How have European colonies helped preserve this world order, in the view of Roy?

Answers

Answer:

The fact that, in spite of its general bankruptcy, European capitalism is still ... war shook the very foundation of the capitalist order in European countries, ... As a result of the War, the world finds itself divided today into two great colonial empires, ... The point of view that the peoples of the East – given that, in general, they are.

Explanation:

explan the following concept
a) Red army
b) civil war​

Answers

Answer:

Explanation:The Workers' and Peasants' Red Army, frequently shortened to Red Army was the army and the air force of the Russian Soviet Federative Socialist Republic and, after 1922, the Union of Soviet Socialist Republics. The army was established immediately after the 1917 October Revolution

A civil war, also known as an intrastate war in polemology, is a war between organized groups within the same state or country. The aim of one side may be to take control of the country or a region, to achieve independence for a region or to change government policies.

In what ways did communism have an impact on world history in the first half of the twentieth century?

Answers

Answer:

The ideology of Communism spread after Russia adopted this political and economic ideology in 1917. Communism had a major impact on the world's history during the first half of the Twentieth century.

Explanation:

Communism was a political and economic ideology conceived by Karl Marx in the nineteenth century.

In 1917, after Vladimir Lenin rose to power in Russia, he adopted the ideology of communism. Soon, communism began to spread across the borders of Russia to China, Germany, Romania, Czechoslovakia, North Korea, Poland, and many others.

The spread of communism worldwide became a threat for America. It was this fear that caused the Cold War between Russia and America from 1947 to 1953.

Jeffrey, a registered Republican, has been energized and influenced by the campaign that Joe Biden, a democrat, has been running during this election. As New Jersey's nominating selection was approaching he decided to vote for Joe Biden in the election. In New Jersey's, anyone can vote during this style of nominating method. However, they can only vote once. Which form of the nominating process is being described in this scenario?

1.open primary
2.caucuse
3.closed primary
4.nominating convention

Answers

Answer:

1.open primary

Explanation:

a primary election in which voters are not required to declare party affiliation.

True or false? many white southern men couldn't vote until the end of reconstruction?

Answers

Answer:

its true

Explanation:

What happened on October 4. 1957?

A The Soviet Union launched a missile at the United States

B The United States launched a missile at the Soviet Union

C The Soviet Linion launched the first artificial satellite Sputnik

D The United States launched the first artificial satellite, Sputnik

What was so scary about Sputnik

A Non man-made technology had ever been launched into space C Nobody knew where it would land if it fell back to Earth

B The same technology that launched Sputnik could be used to launch a nuclear warhead at any city on the planet

D There was nothing scary about Sputnik

Who was the president of the United States during the Sputnik launch

A Dwight . Eisenhower

B Franklin D. Roosevelt

C John F. Kennedy

D Barack ll. Obama

Answers

Answer:

1. What happened on October 4, 1957?

The Soviet Union launched the first artificial satellite, Sputnik

2. What was so scary about Sputnik?

The same technology that launched Sputnik could be used to launch a nuclear warhead at any city on the planet

3. Who was the president of the United States during the Sputnik launch?

Dwight D. Eisenhower

4. What marked the end of the space race?

The leaders of the two nations agreed to collaborate

5. Which one of these advancements is NOT directly related to the space program?

Television

Use a spelling word to complete the sentence.

Measles is a common
often associated with childhood.

Answers

Virus often associated with childhood.

Answer:

disease is the answer

Explanation:

I got this question as well

Hope this helps! have a great day!

Other Questions
Which molecule is produced in the aerobic breakdown of a glucose molecule?A. WaterB. OxygenC. LightD. AlcoholE. NADPH Pushing a baby on a swing is easier than pushing an adult on the same swing. Water spills from a glass carried by someone who is walking steadily and suddenly stops short. When thrown with the same force, a soccer ball accelerates more than a bowling ball. A magician pulls a tablecloth out from under a dish on a table without disturbing the dish. A rocket launches into space, pushing fuel exhaust in one direction and the rocket in the opposite direction. A book rests on top of a shelf and does not move until a student accidentally knocks it off. CO Use the following coordinate plane to write the ordered pair for each point Maria has 3 more than Jose. If Jose has x dollars, how much money do they havetogether? What are the five main phases of the cell cycle? What are the main events in each? I need help with this question on IXL Locations with extreme climates and few resources tend to have lower populations. True or False? Can someone pleaseeee help and if youre correct ill give brainliest Can someone please help me!?WILL MARK BRAINLIEST :) I NEED HELP ASAP!!!!!!! will give brainliest How does the content of the passage reflect the author's point of view?A. It shows that the author feels hopeless about the fate of our planet.B. It provides facts and statistics showing that the problem of water shortages is growing.C. It shows that the author dislikes the fact that cities are growing faster in the southwest than elsewhere.D. It shows that the author approves of ongoing scientific research. How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly