Please please help me!!!

Please Please Help Me!!!

Answers

Answer 1

Answer:

1. Hormones

2. Reproductive system

Explanation:

the endocrine system is responsible for producing hormones, and the hormones produced by the pituitary gland regulate reproductive systems.


Related Questions

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Other Questions
Which set of ordered pairs can be used to graph the equation y = x 2 when the first railroads were built , what problem often occurred in transferring from one railroad line to another one what is the value of the expression3.5+(1+4)x(6.5+1.5) The grocery store has 3 times as many cashiers in late afternoon than in the morning. If there are 14cashiers at 10:00 am, how many would there be at 4:00 pm? The Perelli family owns a restaurant downtown. The restaurant is called Perelli's pizza place. They make fresh pizzas every day. The restaurant is very popular. The vegetable pizza at Perelli's is perfect. Question Which corrects the error in capitalization in this paragraph? Answer options with 4 options 1. The Perelli Family owns a restaurant downtown. 2. The restaurant is called Perelli's Pizza Place. 3. The Restaurant is very popular. 4. The Vegetable Pizza at Perelli's is perfect. Choose the word that correctly completes the analogy.common : scarce :: human-made : _____A: Process B: CavernC: ChalkD: Natural--------------------------What would be the answer to this? Samantha saw two bottles of ketchup at the store for the same price. One bottle contained 4 pints of ketchup, and the other contained 1.25 quarts of ketchup.Which bottle was the better bargain? HELP ASAP!!! Move the following states to their correct location on the map. Then move the other items (battles, eities, waterway to their correct location. What is the value of F ? what is survival of the fittest means in yourown words. What was the biggest disagreement at the Constitutional Convention?A: Who should become president.B: How many representatives each state should use.C: If the USA should go to war with Great Britain. Rewrite the function f(x)=2(x-2)^2+6 in the form f(x)=ax^2+bx+c. 11511.5Find the area of the shaded region Grumpy Corp drug tests all of the recent college graduates it hires each year. The drug test currently used correctly determines drug users 96% of the time(a Positive test) and correctly determines non-users 90% of the time(a Negative test). A recent study concluded that 36% of college students use drugs. A potential employee has been tested and the result was Negative for drug use.Required:a. Construct ALL necessary probabilities using proper notation(Example: P(D) for a "drug user").b. Find the Probability of a Negative test, by showing use of the above Probabilities first, and then followed by the proper calculation. What is 6 x 1/2 a.7/8 b. 6/2 c. 6/12 d. 7/2 Book review for the novel Flowers for Algernon 300-500 words, plz guys help me with this Read the sentence.Last year at the City Science Exhibition, three projects were presented by the students of our school.Which revision changes the sentence from the passive voice to the active voice? A. Three projects were presented by the students of our school last year at the City Science Exhibition. B. Last year, the students of our school presented three projects at the City Science Exhibition. C. Last year, the City Science Exhibition had three projects presented by the students of our school. D. Three projects were presented at the City Science Exhibition last year by the students of our school. By the end of the 1920s, was not keeping pace with production.When businesses produce more goods than can be sold, occurs.Overproduction causes businesses to . What are some differences between past and modern snakes? Can you put this in your own words?"An open circuit is one where the continuity has been broken by an interruption in the path for current to flow."