Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Please Help :). Will Give Brainiest!! I Only Need The First Part Dont Answer #2 Or #3

Answers

Answer 1
It should be
AGATACCATGGTTACCCGGTTCCA

Related Questions

Select the correct answer from each drop-down menu.
The rule of law is important because it
In regard to governments the rule of
law

Blank 1

protects citizens from crime and injustice

helps reduce the number of Supreme Court cases

ensures that an innocent person is not accused of a crime

Answers

Answer:

helps reduce the number of Supreme Court cases

Explanation:

all three are true but in regards to the govenment, the second option should be selected

What is the last process of the cell cycle during which two new daughter cells are formed?
A. cytokinesis
B. S phase
C. G2 phase

Answers

the answer would be A!

Which strategy is most likely to prevent food-borne illnesses, like salmonellosis?

PLEASE HURRY!!!!!
NO LINKS!!!!!!
CORRECT ANSWERS ONLY!!!!!!

Avoid all types of meat and other products from animals.
Treat all food products with antibiotics or disinfectants.
Practice safe food handling and cook foods thoroughly.
Inoculate people with vaccines that prevent infections.

Answers

Answer:

Practice safe good handling and cook foods throughly

Explanation:

Because by practicing safe cooking habits you can cook off some viruses and germs.

Agricultural chemicals are one source of water pollution. What is one way we can reduce their effects?"
a. biological magnification
b. nonpoint source pollutant
c. integrated pest management
d. sewage treatment

Answers

Answer:

what I think it is it's C?

I think it’s C hope it helps

Which of the following can be described as the following: Similar development of a trait in distinct species, originating from a common ancestral condition
A Coevolution
B Parallel Evolution
C Divergent Evolution
D Convergent Evolution

Answers

The answer is D. Convergent evolution

Before a plant grown in a greenhouse can be planted in a field or garden, it should first be______ off.
Fill in the blank please. \
If you use links ill report it.

Answers

Answer:

hardening off

Explanation:

How did the Tang and Song dynasties differ from the later Ming dynasty?
They followed isolationist policies.
They forbade Buddhist philosophies.
They promoted Confucian practices.
They welcomed and expanded trade.

Answers

The Tang and Song dynasties differ from the later Ming dynasty in that the latter  welcomed and expanded trade.

What are the dynasties of China?

China was part of the earliest civilization that had already risen in the early centuries BC. There were several dynasties that ruled China and each was controlled by a powerful emperor who had the army in complete obedience.

The Tang dynasty ruled China after the fall of the  Sui Dynasty (581-618 CE). It was a time of prosperity in China. The Tang and Song dynasties were supportive of trade however, they were also conservative and did not like the excessive influence of foreign ideology into China.

After the demise of the Tang and Song dynasties, the  Ming dynasty came into power and supported, expanded and encouraged trade with foreign nations.

Hence the Tang and Song dynasties differ from the later Ming dynasty in that the latter  welcomed and expanded trade.

Learn more about the  Tang and Song dynasties: https://brainly.com/question/1961463

Answer:

They welcomed and expanded trade.

CAN SOMEONE PLEASE HELP ME ON THIS QUESTION ASAP!!!!!! GIVING 12 POINTS AWAY!!!!!

Answers

Answer:

xylem

Explanation:

I answered this question for a warm up in plant science

The main purpose of the ______ system is to distribute blood throughout the body.
A. musculoskeletal
B. circulatory
C. digestive
D. respiratory

Answers

Answer:

B. circulatory

Explanation:

Answer: B

Explanation: The circulatory system delivers oxygen and nutrients to cells and takes away wastes. The heart pumps oxygenated and deoxygenated blood on different sides. The types of blood vessels include arteries, capillaries and veins.

Please help with this, will give brainlist to best answer

Answers

Answer: A: Peripheral

Explanation:

which of the following is not a factor of climate( look at picture) and please answer 4 and 5 also

Answers

So this one is able to be chosen by the way you can only understand and also this is a waste of time reading this bye

A scientist is observing various phenomena in the environment. He wants to plot the position of various objects as a function of time. Which plot will yield a periodic wave?
A.
the position of a baseball player rounding the bases
B.
the position of a roller-coaster car traveling along a track
C.
the position of a sticker on a wheel rolling along the road
D.
the position of a raindrop falling to the ground

Answers

Answer:c

Explanation:

Answer:

c

Explanation:

the position of a sticker on a wheel rolling along the road

A study on the impacts of urbanization was performed for the town of Fairvale. The study showed a decline in biodiversity over the thirty-year span of the study. Which solutions could BEST be implemented to reduce the impacts on biodiversity? Select ALL that apply

Answers

Answer:

A & C

Explanation:

usa test prep

Some of the methods that can be adopted to reduce the impact of urbanization on biodiversity which are establishing green spacing, promoting sustainable development, limiting habitat fragmentation, and implementing conservation programs.

What is biodiversity?

Biodiversity involves the variety of living organisms living on earth, such as plants, animals, fungi, and microorganisms. Biodiversity is essential for the proper function of the ecosystem, thereby, providing numerous benefits to humans.

However, biodiversity is under threat due to urbanization in Fairvale.  The following methods can be adopted to reduce the impacts of urbanization on biodiversity which are establishing green spaces by constructing more green parks, gardens, etc.

Promoting sustainable development through the use of renewable resources and implementation of green building standards are other methods to reduce the impacts of urbanization on biodiversity. Implementing conservation programs and educating the public are other methods useful for promoting biodiversity.

Therefore, establishing green spacing, promoting sustainable development, and implementing conservation programs are some of the methods of promoting biodiversity in Fair value.

Learn more about biodiversity here:

https://brainly.com/question/13073382

#SPJ2

What landform will this erupting volcano make? A) a delta B) a valley C) a canyon D) a mountain

Answers

The answer is D I believe

please help with this, for my science class

Answers

Answer:

1. true. 2. spinalcord.

Select a hypothesis above that would help restore equilibrium and explain your reasoning.

Answers

Answer:

analize data and draw a conclusion

the inside of the blastula is called __

Answers

I think a blastomere

The function of the nervous system is to

Answers

Explanation:

The nervous system is involved in receiving information about the environment around us (sensation) and generating responses to that information (motor responses). The nervous system can be divided into regions that are responsible for sensation (sensory functions) and for the response (motor functions).

"Reduce, reuse, recycle' has long been the mantra of the Environmental Protection Agency in educating communities
on saving money, energy, and natural resources. Your tab group has been tasked with educating your school on how to
reuse materials so that there is less waste What pieces of information should you include in your presentation?
Choose ALL that apply

Answers

Answer:

All of them

Explanation:

Answer:

B, C, D

Explanation:

One side of section of DNA is shown below. A-G-C-T-T-G-A Which of the following would be the matching side of the section of DNA?
F A-C-G-T-T-C-T
G T-C-G-A-A-C-T
H A-G-C-T-T-G-A
J C-T-A-G-G-A-G

Answers

Answer:

G) TCGAACT

Explanation:

Define the main processes involved in the water cycle

Answers

Answer:

The water cycle consists of three major processes: evaporation, condensation, and precipitation. Evaporation is the process of a liquid's surface changing to a gas. In the water cycle, liquid water in the ocean, lakes, or rivers) evaporates and becomes water vapor.

Explanation:

There are two main ways this happens: Heat from the Sun causes water to evaporate from oceans, lakes and streams.

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Which of the following objects is a good candidate for composting?

Answers

Answer:

Banana

Explanation:

It is biodegradable

natural selection results and change over time by acting on trates that are???

Answers

natural selection results and change over time by acting on traits that are new
B. Heritable.

Disregard other answer, that is horribly wrong.

A minor object orbiting in a solar system is a(n)
asteroid
regolith
meteorite
meteor

Answers

(A asteroid
their tiny and orbit the planets apparently lmk if i’m incorrect

Select the correct answer.
Many farmers in United States rear animals for their meat and wool. The animals remain in confined spaces and feed on grains. Farmers give
growth hormones to these animals to hasten and increase their growth. Which type of farming are these farmers practicing?
OA. traditional livestock ranching
OB
modern livestock ranching
Ос. .
sedentary tillage
OD
nomadic herding

Answers

Answer:

D nomadic herding

Explanation:

I believe this is the correct answer

Some sugar is added to cold water in a beaker.
After some time, all the sugar dissolves and spreads throughout the water.
(a)(¡) Name the process that occurs which causes the sugar to spread throughout the water.
(ii) State two ways to make the sugar dissolve more quickly.
(b) Pure water can be obtained from the sugar solution using this apparatus.
Name the process used to obtain pure water from the sugar solution.

Answers

Answer:

(i) dissolved

(ii)increase stirring rate & increase the temperature of the water

(iii)evaporation

Answer:

((A))

(i) The sugar is in its melting/dissolving phase.

(ii)You can either increase stirring rate & increase the temperature of the water.

(iii)The process is called evaporation.

Explanation:

10. DNA can best be compared to
O the bricks that make up a building.
O an instruction manual.
the people that live in a building.
O the different apartments and offices in a building.

Answers

Answer:

An instruction manual because DNA is what determines everything about you

DNA can best be compared to an instruction manual. Thus, the correct option for this question is B.

What is DNA?

DNA stands for Deoxyribonucleic acid. It may be characterized as a type of molecule that is generally present inside cells and contains the genetic information which is ultimately responsible for the development and function of an organism.

The molecules of DNA allow this information to be passed from one generation to the next. According to the question, as DNA represents each and every piece of information about an organism, similarly an instruction manual describe all the processes and function of any object or thing.

Therefore, DNA can best be compared to an instruction manual. Thus, the correct option for this question is B.

To learn more about DNA, refer to the link:

https://brainly.com/question/2131506

#SPJ5

Which of the following is the main idea of paragraph 2?
A. Offspring have a combination of traits from their parents
B. Parents have different traits that are passed on to their offspring
C. Genes control the traits particular humans possess
D. Red hair is a trait that is inherited from one’s parents
Paragraph 2:
Genes control everything about us: our hair color, skin color, sex, height, etc. Imagine looking at a picture of two parents and their children. You might see that the mother has certain traits. The father has other traits. Their children usually have a mixture of those traits.

Answers

Answer:

ierieieieeoeoeieiririiekkek

a or c, or b it comes down to those

What is the name of the process where a scientist alters the characteristics of an organism by manipulating its DNA?

genetic engineering

animal engineering

mendelian engineering

mutation engineering

Answers

A) Genetic Engineering; this is the logical and « real » choice.

Genetic engineering

I took the test and got it right. I hope this helps!!! :)

Other Questions
solve 42-63+324using MDAS?? Which three-dimensional solid could be represented by this net? why did the air patrol not include Puerto Rico and the virgin islands QUESTION 1Which of the following is true of W.E.B. Du Bois's childhood?A. He was born a slave.B. He was raised on a plantation in the South.C. He was raised in a predominantly white town in Massachusetts.D. He dropped out of school as a teenager.QUESTION 2W.E.B. Du Bois was the first African-American to...A. attend Harvard University.B. earn a doctorate.C. disagree with Booker T. Washington.D. fight for civil rights for African-Americans.QUESTION 3Which of the following most accurately describes the disagreement between Du Bois and Booker T. Washington?A. Washington emphasized education for blacks, and Du Bois thought education was not important.B. Washington supported slavery, and Du Bois did not.C. Washington thought African-Americans should form a new country of their own, and Du Bois wanted African-Americans to assimilate into white society.D. Washington thought blacks should focus on economic self-sufficiency rather than political equality, and Du Bois thought political equality was critical. How did the United States change after World War II I NEED THIS ASAP I WILL MARK YOU THE BRAINLIEST LINKS WILL BE REPORTEDput the correct terms with the correct pictures Given AE EC, for what value of x is quadrilateral ABCD a parallelogram? Which statement is true?- A checking is account is where you want to keep all of your money for spending and saving,-A checking account is where you want to keep your spending money and a savings account iswhere you want to keep your savings-A checking account is where you want to keep your savings and a savings account is where youwant to keep your spending money,A savings account is where you want to keep all of your money for spending and saving. Which object is NOT a form of chemical energy? Elabora un comentario de lo que significa el amor propio en una pagina. Will give brainliest to best answer Karen dosent like dogs because one pooped within 200 feet of her house 12 years ago, and a veteran moved in across the street with an emotional support dog that never barks and is usually in his fenced back yard. What will the Karen be most likely to do, and what must be done in turn?A: attempt to feed the dog poised meat; plant an ignition bombB: report the owners dog to the county for attempting to attack her to have it put down; make a little gas leak with a timerC: call the police every day + harass the owner; order various types of animal droppings to her houseD: Try to force you to make your dog vegan; tie karen to weed wacker and make it eat the weeds around your house assuming you can carry 2 tons. HELPPPP I have a job interview tmr for a summer camp and I already know the guy interviewing me. Any tips??? answer number 12 for me I Need help ASAP it is due today 5/26/21 The length of a rectangle is (x + 3) inches long, and the width is 3.4inches. If the area is 15.3 square inches, which equation can be used to findx? *A. 3.4(x + 3) = 15.3B 3.4x + 3 = 15.3C. 3(x + 3.4) = 15.3D. 3x + 3.4 = 15.3 Neither ,she , my friend nor I ............ going to the party.A.isB.amC.are Can someone help me please Help, quickly if possible. 100 point is me am have it you get it me am you am HA 1.extermination of millions of Jews, Slavs, and Gypsies in death camps