middle school math problem

Middle School Math Problem

Answers

Answer 1

Answer:

part b is 32

Step-by-step explanation:


Related Questions

mr. denson has a sqaure

Answers

Answer:

Nice square Mr. Denson.

Step-by-step explanation:

Write the standard form of the equation of the circle with center (7,1) that also contains the point (−1,−5).

Enter the equation in simplest terms.
pls no links. my computer can't open

Answers

Answer:

[tex](x-7)^2+(y-1)^2=100[/tex]

Step-by-step explanation:

1) Find the radius

We can do this by using the distance equation with the centre (7,1) and the given point (-1,-5):

[tex]d=\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex] where the two points are [tex](x_1,y_1)[/tex] and [tex](x_2,y_2)[/tex]

Plug in the points (7,1) and (-1,-5)

[tex]d=\sqrt{(-1-7)^2+(-5-1)^2}\\d=\sqrt{(-8)^2+(-6)^2}\\d=\sqrt{64+36}\\d=\sqrt{100}\\d=10[/tex]

Therefore, the radius of the circle is 10 units.

2) Plug the data into the equation of a circle

Equation of a circle (when not centred at the origin):

[tex](x-h)^2+(y-k)^2=r^2[/tex] where the centre is [tex](h,k)[/tex] and r is the radius

Plug in the centre (7,1) as (h,k)

[tex](x-7)^2+(y-1)^2=r^2[/tex]

Plug in the radius 10

[tex](x-7)^2+(y-1)^2=10^2\\(x-7)^2+(y-1)^2=100[/tex]

I hope this helps!

3) Kweku had 300 mangoes. He sold
240 of them - What is the percentage of
mangoes left.​

Answers

Answer:

20%

Step-by-step explanation:

300 - 240 = 60  ÷  300 = 20% mangoes.



Cooking oatmeal requires 1 cup of water for every
cup of oats. How many cups of water will be required for
3/5
cup of oats?

Answers

Answer:

have no idea

Step-by-step explanation:

Hope someone else answers and sorry that ai didn't answer

pls who can help me ans my maths questions plssss and I will give you a brainliest ​

Answers

Answer:

but please where is the question?

simplify
[tex] {a}^{2} - {b}^{2} [/tex]

Answers

Answer:

a² - b²

= (a+b) (a-b)

Hope it helps!

1. Which of the following sets of integers is arranged in order from LEAST to GREATEST?
Oi-1.5 - 9
O (1. - 5. - 10)
O (12. - 8,0)
O { - 13. - 12,9)

Answers

Answer:

Last option:

(-13, -12, 9)

Step-by-step explanation:

Here you need to look at a number line.

(an infinite line with the zero in the middle, at the left we have the negative numbers which increase to the left, and at the right, we have the positive numbers that increase to the right)

for any two pair of numbers in the number line, the number at the right is larger than the number at the left.

So for example, -10 is at the left of -3

Then:

-10 < -3.

Then a set is ordered from least to greatest if:

first we have the largest negative numbers

then the smaller negative numbers

then the zero (if there is a zero)

then the smaller positive numbers

then the largest positive numbers.

The only set that meets this condition is the last one:

(-13, -12, 9)

Why the others not meet this condition?

in the first one we have -9 after 5, and we know that -9 < 5

in the second one we actually have an order from greatest to least.

in the third one we have -8 at the right of 12, and we know that -8 < 12

Rewrite the expression by combining like terms.
8y^2 + 7xy – 2y^2 - 5xy + 2x

Answers

6y²+2xy+2x

Step-by-step explanation:

8y²-2y²=6y²

7xy-5xy= 2xy

2x=2x

God 7: buogjfhfhgghuhyyhhhhhhhhh

A snail crawled 7 miles in 8.4 hours. At this speed, how long would it take the snail to crawl 10 miles?

Answers

12 hours I think. Hope this helps.

Answer: 12 hours

Step-by-step explanation:

Let's set the speed as "s".

Remember that distance = speed * time

So, plugging the numbers given...

7 = s * 8.4

Divide both sides by 8.4

s = 5/6

Now, plug this into the distance = speed * time, with the distance being 10. Set the time as "t"

10 = 5/6 * t

Divide both sides by 5/6

12 = t

So, it would take 12 hours for the snail to crawl 10 miles.

Match the proportion to the correct value of x .

1. [x/9] = [4/3] A. x= -32
2. [3/x] = [5/8] B. x=16
3. [(x+4)/10] = [4/2] C. x= 12
4. [(x+4)/2] = [(x-10)/3] D. x=4.8

Answers

Answer:

1. C

2. D

3. B

4. A

Step-by-step explanation:

Answer:

1. C

2. D

3. B

4. A

Step-by-step explanation:

FInd the unknown value of:
18 = 3 + x
x = ?

Answers

the answer to the equation is x=15

4. There are 11 shelves that contain 5,676 rolls of tape. How many rolls are on each shelf?
a. 56
b. 506
C. 516
d. 526

Answers

C, 516. You would take 5,676/11 and get 516

Help please include explanation screenshot attached and brainliest to correct answer

Answers

Answer:

x>-8 (Or option D)

Step-by-step explanation:

-2x+7<23 Subtract 7 from both sides

-2x<16 Now divide by -2. You also have to flip the < sign because you are dividing by a negative number

x>-8

The reasoning for D over C is because D is an open circle meaning that it is only less than or greater than. When it is a closed circle, it means less than or equal to or greater than or equal to. :)

find the volume of cuboid whose Length breadth and height are 3cm 4cm and 5cm respectively​

Answers

Answer:

volume of cuboid(v)=l*b*h

3cm*4cm*5cm

60cm cube

Please find how to get answer of attachment below.

Answers

Answer:

The 52th card that was dealt was an 8.

Step-by-step explanation:

The total value of the entire deck is [tex]4(1 + 2 + \cdots + 9 + 10 \cdot 3) = 4(\frac{10 \cdot 11}{2} + 20) = 220 + 80 \equiv 0 \mod 10.[/tex]

The total value of the 51 cards face-up is congruent to [tex]0 + 3 + 6 + 1 + 10 + 10 + 4 + 8 = 42 \equiv 2 \mod 10.[/tex]

The 52th card must therefore be an 8 for the total value of the entire deck to be 8 mod 10. (Or, rather, we have that the last card must be [tex]0-2 \equiv 8 \mod 10[/tex] and the only card that is congruent to that value modulo 10 is the 8.)

A group of 80 people who had been diagnosed as prediabetic because of high blood glucose levels volunteered to participate in a study designed to investigate the use of cinnamon to reduce blood glucose to a normal level. Of the 80 people, 40 were randomly assigned to take a cinnamon tablet each day and the other 40 were assigned to take a placebo each day. The people did not know which tablet they were taking. Their blood glucose levels were measured at the end of one month. The results showed that 14 people in the cinnamon group and 10 people in the placebo group had normal blood glucose levels. For people similar to those in the study, do the data provide convincing statistical evidence that the proportion who would be classified as normal after one month of taking cinnamon is greater than the proportion who would be classified as normal after one month of not taking cinnamon?

a. No conclusion can be made about the use of cinnamon because the people in the stuey were volunteers
b. There is convincing statistical evidence at the level of 0.01
c. There is convincing statistical evidence at the level of 0.05 but not at the ver.01
d. There is convincing statistical evidence at the level of 0.10 any reason
e. There is not convincing statistical evidence

Answers

Answer:

E

Step-by-step explanation:

AP Classroom says so.

The data doesn't provide convincing statistical evidence for considered proportion comparison. We deduce that: Option E: There is not convincing statistical evidence

How to form the hypotheses?

There are two hypotheses. First one is called null hypothesis and it is chosen such that it predicts nullity or no change in a thing. It is usually the hypothesis against which we do the test. The hypothesis which we put against null hypothesis is alternate hypothesis.

Null hypothesis is the one which researchers try to disprove.

How to calculate the value of z-test statistic for two sample proportions?

Suppose we have:

[tex]\hat{p}_1[/tex] = first sample's proportion[tex]n_1[/tex] = first sample's size[tex]\hat{p}_2[/tex] = second sample's proportion[tex]n_2[/tex] = first sample's size[tex]\hat{p}[/tex] = overall proportion

Then, we get:

[tex]Z = \dfrac{\hat{p}_1 - \hat{p}_2}{\sqrt{\hat{p}(1-\hat{p}_1 )(\dfrac{1}{n_1} + \dfrac{1}{n_2}) }}[/tex]

If the level of significance = [tex]\alpha[/tex]critical value of Z is: [tex]Z_{\alpha/2}[/tex], and if [tex]Z > Z_{\alpha/2}[/tex]null hypothesis, else if [tex]Z_{\alpha/2} > Z[/tex] then we cannot reject it.

For this case, we want to know if  the data provides convincing statistical evidence that the proportion who would be classified as normal after one month of taking cinnamon is greater than the proportion who would be classified as normal after one month of not taking cinnamon.

Thus, we get our hypotheses as:

Null hypotheses: They don't provide convincing evidence (and thus, cinnamon had no improvement on the proportion), and thus:

[tex]H_0: \hat{p}_1 \leq \hat{p}_2[/tex]

Alternate hypothesis: Data provides convincing evidence (that the use of cinnamon made increment in considered proportion), and thus:

[tex]H_a: \hat{p}_1 > \hat{p}_2[/tex]

The test is single tailed.

For this case, we have:

[tex]x_1[/tex] = quantity of intended object found in first sample = 14 (of those who take cinnamon tablets each day)[tex]n_1[/tex] = first sample's size = 40[tex]\hat{p}_1 = x_1/n_1 = 14/40 =0.35[/tex] [tex]x_2[/tex] = quantity of intended object found in second sample = 10 (of those who take placebo each day)[tex]n_2[/tex] = second sample's size = 40[tex]\hat{p}_2 = x_2/n_2 = 10/40 =0.25[/tex][tex]\hat{p}[/tex] overall proportion = [tex](x_1 + x_2)/(n_1 + n_2) = (10 + 14)/80 = 0.3[/tex]

Thus, we get:

[tex]Z = \dfrac{\hat{p}_1 - \hat{p}_2}{\sqrt{\hat{p}(1-\hat{p}_1 )(\dfrac{1}{n_1} + \dfrac{1}{n_2}) }} =\dfrac{0.35 - 0.25}{\sqrt{0.3(0.7 )(\dfrac{1}{40} + \dfrac{1}{40}) }} \approx 0.976[/tex]

At 0.01 level of significance ([tex]\alpha = 0.01 = 1\%[/tex]), we get the critical value of Z from z-tables as:

[tex]Z_{\alpha/2} = 2.576[/tex]

Since [tex]Z_{\alpha/2} > Z[/tex] , we cannot reject the null hypothesis, and thus, deduce that there is not convincing statistical evidence at the level of 0.01

At 0.05 level of significance ([tex]\alpha = 0.05 = 5\%[/tex]), we get the critical value of Z from z-tables as:

[tex]Z_{\alpha/2} = 1.96[/tex]

Since [tex]Z_{\alpha/2} > Z[/tex] , we cannot reject the null hypothesis, and thus, deduce that there is not convincing statistical evidence at the level of 0.05

At 0.10 level of significance ([tex]\alpha = 0.10 = 10\%[/tex]), we get the critical value of Z from z-tables as:

[tex]Z_{\alpha/2} = 1.645[/tex]

Since [tex]Z_{\alpha/2} > Z[/tex] , we cannot reject the null hypothesis, and thus, deduce that there is not convincing statistical evidence at the level of 0.10

Remember that the conclusions can be made even if they were volunteers since that doesn't make it wrong as volunteers are randomly coming out people from real population.

Thus, we deduce that: Option E: There is not convincing statistical evidence

Learn more about two proportions z-test here:

https://brainly.com/question/4757147

how many 15/16 pins can be cut from a 3 foot rod if 3/32 waste is allowed for each cut?​

Answers

Answer:

(15/16)" + (3/32)" = (33/32)" = 1.03125" of material from the rod. since each pin needs to be (15/16)" = 0.9375" we have enough rod for one more pin.

For the following right triangle, find the side length x. Round your answer to the nearest hundredth.
8
9

Answers

A squared plus b squared equals c squared. 8 squared is 64 and 9 squared is 81. 64+81 is 145. 145 square root is rounded to 12.

The sum of the interior angle measures of a convex polygon is 540° . How many sides does it have?

Answers

The answer
5
Explanation
The shape is a pentagon

Is x=5 a solution to the equation: 4x=20

Answers

Yes it would be!!!!!!!

Answer:

Step-by-step explanation:

4(x-5)=4x-20

4x-20=4x-20

+20 +20

4x=4x

-4x -4x therefore there's infinite solutions

0=0

What is the ratio of 4 to 12

Answers

Answer:

3?

Step-by-step explanation:

Steve has a square patio with sides of length 9 feet. He plans to enlarge it to a rectangular patio by

increasing the length by 3 feet and the width by 2 feet. How many square feet in area will be added to the

patio?

06

O 12

0 29

O 51

Answers

Answer:

51ft^2

Step-by-step explanation:

Given data

Side of square patio= 9ft

Area= 9*9= 81 ft^2

New length = 9+3= 12ft

New Widht = 9+2= 11ft

New Area= 12*11

New Area= 132ft^2

Hence the area added is

=132-81

=51ft^2

The 51 square feet area will be added to the patio if the length is increased by 3 feet and the width is by increased  2 feet, Option fourth is correct.

It is given that steve has a square patio with a side length of 9 feet he plans to enlarge it to a rectangular patio by increasing the length by 3 feet and the width by 2 feet.

It is required to find how many square feet in the area will be added.

What is the area?

In mathematics, the area is the space occupied by the 2-dimensional figure or surface.

We know the formula for finding the area of square 'A'

[tex]\rm A= a^{2}[/tex]  where a is the length of the side.

We have a = 9 feet

[tex]\rm A= 9^2\\\rm A= 81 \ Feet^2[/tex]

Increasing the length by 3 feet and the width by 2 feet respectively, wet get:

L =  9+3  ⇒ 12 Feet

W = 9+2 ⇒ 11 Feet, Where L is the length and W is the width of the rectangle.

Area of rectangle = L×W

Area of rectangle = 12×11

Area of rectangle = 132 [tex]\rm Feet^2[/tex]

The area which will be added = (Area of rectangle) - (area of square)

The area which will be added = (132) - (81)

The area which will be added = 51 [tex]\rm Feet^2[/tex]

Thus, the 51 square feet area will be added to the patio.

Learn more about the area here:

https://brainly.com/question/1658516

1. Solve the inequality 2x-5>11​

Answers

Answer:

X=9

Step-by-step explanation:

2(9)-5 > 11

18-5 > 11

13>11

2x-5>11

2x-5+5>11+5 five will be cancelled five

2x>11+5

2x>16 divide 2 by 2 you get x then divide 16 by 2

x>8 this means x is greater than eight {x= 9,10,11,12.......}

Solve the following inequality
4 + 6x ≤ x + 6x
Select one:
A. x ≤ 4
B. x ≥ 4
C. x > 4
D. x < 4

Answers

Answer:

x ≥ 4

Step-by-step explanation:

The given inequality is :

4 + 6x ≤ x + 6x

Subtract 6x from both sides,

4 + 6x-6x ≤ x + 6x -6x

4≤ x

or

x ≥ 4

Hence, the correct option is (b) i.e. x ≥ 4.

Someone help me :') picture attached

Answers

Answer:

the slope of the line is -4

Step-by-step explanation:

Answer:

-3

Step-by-step explanation:

Question
What was the equation of the graph below before it was shifted to the right 1
unit?

Answers

B
I think sorry if wrong

Type the correct answer in each box. Use numerals instead of words.
What is the inverse of this function?
f(x)=-V7 + 3, * > -3
x²-0 for xs

Answers

Answer:

4

3

0

Step-by-step explanation:

Shipping Box Fish Food 11 ft 37 ft 1 ft 1 ft 3 ft 3 ft​

Answers

Answer:

Dude post it again lol

Step-by-step explanation:

The picture is so blurry

ano ang katangian ng isang bionote?​

Answers

Explanation:Ang bionote ay hindi tulad ng isang karaniwang Tala buhay kung saan niroromantisa ang naging buhay ng tampok na indibidwal. Ang bionote ay isang maikling talata na naglalaman ng isang pinaikling talambuhay. Pinaikli, sapagkat't ito ay naglalaman na lamang ng mga impormasyon na totoo at direkta.

Karaniwang nilalagay lamang sa bionote ang lugar ng kapanangakan, pinag-aralan, nakamit ng mga pangaral,at mga naisulat na akda

Suppose that 5% of the time Todd attends a concert twice a month, 40% of the time he attends a concert once a month, and 55% of the time he doesn't attend a concert at all in a given month. What is the expected value for the number of times Todd attends a concert during a month?

Answers

Answer:

The expected value for the number of times Todd attends a concert during a month is 0.5.

Step-by-step explanation:

We have these following probabilities:

5% probability of attending a concert twice a month, which means that P(X = 2) = 0.05

40% probability of attending a concert once a month, which means that P(X = 1) = 0.4

55% probability of not attending a concert during the month, which means that P(X = 0) = 0.55

What is the expected value for the number of times Todd attends a concert during a month?

We multiply each value by its probability. So

[tex]E(X) = 0.05*2 + 0.4*1 + 0.55*0 = 0.1 + 0.4 = 0.5[/tex]

The expected value for the number of times Todd attends a concert during a month is 0.5.

Other Questions
Why should you wait before taking anti-inflammatories? HOLA POR FAVOR AYUDA:(necesito 3 ejemplos de tesis Jack invested $2,900 in an account paying an interest rate of 8 % compoundedannually. Anthony invested $2,900 in an account paying an interest rate of 81%compounded continuously. After 10 years, how much more money would Anthonyhave in his account than Jack, to the nearest dollar?I dont understand how to solve. I NEED HELP PLEASE HURRY The bank has 5 Vaults.Each vault contains 5 drawers 5 stacks and $25 whats in the bank? How many solutions will the equation have?| x 2| = 6 giving brainliest !!!!!!! What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes.