Linnaeus developed two groups for classifying organisms: genus and .

Answers

Answer 1

Answer:

Species

Explanation:

Carl Linnaeus was a Swedish scientist who developed a formal system of naming organisms- bionnomial nomenclature

The first part of the name identifies the genus to which the species belongs, and the second part identifies the species within the genus.

For example the tiger is called "Panthera tigris". The species is tigris (tiger).

The genus is Panthera (which also includes the lion (Panthera. leo), the jaguar (Panthera onca), and the leopard (Panthera pardus). The species is "tigris"

Answer 2

Answer:

Species

Explanation:100% on my test


Related Questions

Describe one way the plants in a desert biome are adapted to survive?​

Answers

Answer:

The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.

Explanation: I hope this help's you some!!

What molecules will carry the electrons to the electron transport chain?

Answers

Answer:

electron and nuetrons

The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.

These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.

The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.

Learn more about the electron transport chain, here:

https://brainly.com/question/33834922

#SPJ4

(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?

Answers

Answer:

Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.

Explanation:

Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!

1. Why were populations able to get so big? What happened that allowed this to happen?

2. What do you think will happen if the populations of humans continued to increase

3. What could happen that could limit the population or cause it to decrease ( Stop growing )

Answers

Answer:

1. reproduction

2. we could run out of food as not enough is produced fast enough

3. lack of food, women and men who are infertile or diseases which can kill people

Which of the following is not true about prokaryotic cells?

Answers

Answer:

Prokaryotes lack a true nucleus with well defined nuclear membrane and other membrane-bound organelles. Mitochondria are the double membrane bound organelle and hence is absent in prokaryotes. Mesosome is an extension of the cell membrane presence in the cytoplasm as infolding and serves to increases surface area and as a site for cellular respiration in prokaryotes. Histones are positively charged proteins that serve in the packaging of negatively charged eukaryotic DNA but are absent in prokaryotes.

So, the correct answer is option A.(DNA is complexed with histones).

The statement which is not true for prokaryotic cell is that they are all parasitic. Thus, the correct option is C.

What is Prokaryotic cell?

Prokaryotes are the organisms whose cells lack a nucleus and other membrane-bound organelles. Prokaryotic organisms are divided into two distinct groups which are the bacteria and the archaea, which scientists believe to have the unique evolutionary lineages. Most of the prokaryotes are small in size, single-celled organisms which have a relatively simple structure.

Examples of prokaryotic organisms are blue-green algae, bacteria and mycoplasma. Among the prokaryotes, bacteria are the most common and multiply very fast.

Therefore, the correct option is C.

Learn more about Prokaryotic cell here:

https://brainly.com/question/18348786

#SPJ6

Your question is incomplete, most probably the complete question is:

Which one of the following is not true of prokaryotes ?

(a) They are living cells

(b) They lack a nucleus

(c) They all are parasitic

(d) They are both archaea and bacteria

What property causes the cohesion of water molecules that moves water through a plant against the force of gravity?

Answers

Answer:

I believe the answer is polarity, though I am unable to find an exact statement.

Explanation:

I believe it is polarity because of the way water moves through a plant and its relation to gravity.

Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?

Answers

Answer:

DNA ligase

Explanation:

Answer: The nucleus

Explanation: I got it right on the test.

You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment

Answers

Answer:

C. Hypothesis

Explanation:

Each student in a science class of 25 performed the same experiment. Each student shares their data and it is
recoded on a class data table. Tamara compared the data that she personally collected in her experiment to the
data collected by the rest of her classmates.
Which of the following might indicate to her that her results are valid?

Answers

Answer: three other classes performed the same experiment.

Explanation:

Which specialized cell type would be found lining the trachea, the part of the body that brings air to the lungs?
A)blood
B)epithelial cells
C)neuron
D)muscle cells

Answers

Answer:

epithelial cells

Explanation:

I hope it works <3

Answer:

Blood

Explanation:

Red blood cells are responsible for transporting oxygen to the different parts of the body.

HELP ASAP 20 POINTS!!!!!!!!!!!!
2 ANSWERS

Answers

Answer:

A, and D

Explanation:

its the answer I believe

Answer:

Nitrogen, Calcium

Explanation:

im pretty sure.

Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?

A.Electron
B.Neutron
C.Nucleus
D.Proton

Answers

Answer:

Nucleus

Explanation:

FIRST TO ANSWER IN DIFFERENT SENTENCES GETS BRAINLIEST

Answers

Answer:

1.An example of Batesian mimicry is when the yummy viceroy butterfly mimics the orange and black coloration of the distasteful monarch butterfly. ... Wasmannian mimicry occurs when the mimic resembles it's host (the model) in order to live within the same nest or structure. For example, several beetles closely resemble ants

2.Orange and black Monarchs (Danaus plexippus) are among the most familiar and easily recognizable butterflies found in the vivarium. Bright colors and distinctive wing patterns can be an example of aposematism, also known as a warning coloration.

Explanation:

please mark me as the brainliest answer and please follow me for more answers to your questions

Which phrase describes one main feature of the atmosphere

Answers

Answer:

protects earth's surface

I hope this helped you!

If 5x+4y=58 and 3x + 7y = 67 find the value of ( x + y ) ​

Answers

Explanation:

5x + 4y = 58 ....1

3x + 7y = 67 ....2

....1 × 3 both sides of the equation

15x + 12y = 174 ....3

....2 × 5 both sides of the equation

15x + 35y = 335 ....4

.....4 - ......3 both sides of the equation

35y - 12y = 335 - 174

23y = 161

y = 161/23

= 7

explain how matter behaves differently than energy in a ecosystem

Answers

Answer:

Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

Help I don’t get it the last one says negative

Answers

Answer:

Negative (Fourth Choice)

Explanation:

According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.

HELPPPPPP ME PLEASEEE

Answers

Answer:

building blocks of life

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. 

Which statement is true? a. Earth’s revolution is circular. b. Earth’s revolution is elliptical. c. Earth’s distance from the Sun is constant. d. Earth’s average distance from the Sun is 2 astronomical units.

Answers

Answer:

B

Explanation:

Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle

Answers

The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Glycolysis

Glycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.

Citric acid cycle

This is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.

Acetyl CoA formation

The pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.

Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539

Answer:

It's B

Explanation:

I took one for the team.

what is the relation between weight of the body and weight of the heart​

Answers

300g in males 200g in females

2. What is the process of making energy within mitochondria called?

Answers

Answer:

Mitochondria Function

Explanation

Cellular respiration is the process of making ATP using the chemical energy found in glucose and other nutrients. In mitochondria, this process uses oxygen and produces carbon dioxide as a waste product.

I took biology last year so I had to dig out my old notes. The correct answer should be mitochondria function. good luck :)

Which list places the layers of the sun in the correct order from innermost to outermost?

Corona, photosphere, chromosphere
Photosphere, convective zone, radiative zone
Convective zone, chromosphere, corona
Radiative zone, corona, convective zone

(the third choice is wrong)

Answers

Answer:  The inner layers are the Core, Radiative Zone and Convection Zone. The outer layers are the Photosphere, the Chromosphere,

Explanation: Hope this helped! :)

How many atoms of each element are in the chemical formula NH4NO3?

1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen

Answers

C - 2 Nitrogen / 4 Hydrogen / 3 Oxygen

hope that helps :)

A man is 1.7 m long. An amoeba is 17 um long. How does the length of the
man compare to the length of the amoeba?

Answers

A man is 100,000 times larger in micrometers than the amoeba, since 17 micrometers is 0.000017 meters, and 1.7 meters is 1,700,000 micrometers

Is it possible for you to be more related to one grandparent than another?

Answers

Answer:

No because you should get half the DNA from your parents meaning you should be related to the grandparents equally

Answer:

The question isn't clear, can you restate it ?

Explanation:

Number 15 which of the following is a function of carbohydrates?

Answers

Answer:

Option (c) cell wall.  

Explanation:

Carbohydrates helps to forms the cell wall.  Cellulose is a carbohydrate and it is found the plant cell wall.

Which statement does NOT accurately describe eukaryotic and prokaryotic cells?

Answers

Answer:

You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.

For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.

Prokaryotic cells are found in the domain(s) Bacteria and Archaea.

True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.

A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.

There is only  _1_ eukaryotic domain, it is Eukarya.

what are the roles of plate tectonics in the continental shelf?

Answers

Answer:

t

Explanation:

Answer:

A continental shelf is a portion of a continent that is submerged under an area of relatively shallow water known as a shelf sea. Much of these shelves has been exposed during glacial periods and interglacial periods. The shelf surrounding an island is known as an insular shelf.

Explanation:

Other Questions
please answer asap !!What is the zero of f?(15 points!) 5 ( f + 4) = 4 ( f - 6) Meg has two glasses of grape juice. Glass A has 80 grams of juice at 30 C. Glass B has 80 grams of juice at 50 C.Which of the following steps will make the kinetic energy of the molecules of the juice in both glasses equal? Decrease the temperature of juice in Glass A by 20 C Increase the temperature of juice in Glass A by 20 C Decrease the temperature of juice in Glass B by 30 C Increase the temperature of juice in Glass B by 30 C An electrician completes 1/6 of a job in 2/3 hour. How long does it take the electrician to complete the job? 2(t-3) - 72 = 0. extracting square roots. with solution please what is the answer? 5 points who says the right answer.thank you. Which problem can be solved using this equation .15m + 35=.25. + 20 Anyone know the answer The graph shows f (x) and its transformation g(x) . Which equation correctly models g(x) ? A) g(x) = 4x-2 + 4B) g(x) = 4x+2 - 4 C) g(x) = 4x+4 + 2 D) g(x) = 4x-4 + 2 Find the equation of the line from the following graph in slope-intercept form: A) y = 3/2x + 2B) y = -3/2x + 2C) y = -2/3x + 2D) y = 2/3x + 2 What type of language register is used between King Anguish and his wife in lines 1-8 of the excerpt?Finding her rage thus put to naught, she ran to King Anguish, and threw herself on her knees beforehim, crying out:'Oh, my lord and husband, here have ye in your house that traitor knight that slew my brother. Mybrother was Sir Marhaus. Sir Marhaus, your champion and noble knight. It is Sir Tramor, as hefalsely calleth himself, but the piece of steel that was taken from my brother's brain fits a notch in hissword.''Alas,' cried King Anguish, 'then am I right heavy, for he is as full noble a knight as ever I knew; andI charge ye, have not to do with him, but let me deal in this matter.'The king went to Sir Tristram and found him fully armed, as if ready to fight for his life, for he knewthat now the truth had been discovered.a: casualb: consultativec: formald: intimate Please help asap thank you so much Which type of sentence is this?During World War I, President Woodrow Wilson kept sheep on the White House lawn andraised money for the Red Cross through the sale of their wool.simplecompoundcomplexcompound-complex steel production growth1) Between 1900 and 2006, total world steel production (increased / decreased)2) In 2006, the United States produced (more / less) steel than it did in 1900.3) In 1900, (north america / asia / europe) had more steel-producing countries than other continents.4) In 2006, the worlds leading steel producers were located in (north america / asia / europe) why sodium is active element... 12x + k = c solve for x Explain how to do it please Translate the sentence into English, then determine if the underlined conjugation is correct. If it is incorrect, write the correct replacement for the underlined word.Las chicas estan de mexico --------(the underlined word is "estan") Ten times a number, x, is one-half the sum of the number and three. Which answer represents this situation?10x=12(x+3)10x+12x+310x=12x+310x+12(x+3) Ancient people domesticated certain plants. Domestication is a process of changing wildlife to better suit human needs.Which is an example of the domestication of plants by ancient people?. raising cropsB. burning fallen leavesC. picking dandelionsD. chopping firewood will give brainliest!