In order to maintain homeostasis, it is most important for an animal to be able to ?
F increase its prey population
O respond to its environment
H change its habitat
o hide from its predators

Answers

Answer 1

Answer:

respond to its environment

Explanation:


Related Questions

why do some scientists believe that humans evolved from apes?

a: because fossil records show homologous structures indicating a common ancestor

b: because humans and apes lived around the same time period

Answers

Answer:

A

Explanation:

Because it is way more logic

The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8. Which statement predicts how the stream's ecosystem will most likely be impacted? A The flow rate of the stream will increase B. The flow rate of the stream will decrease. с The number of fish in the stream will increase. D The number of fish in the stream will decrease.​

Answers

D....................

The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease.​ Thus, option D is correct.

What is the procedure to indicate the pH of the water stream?

The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8.The flow rate of the stream will decrease. The number of fish in the stream will increase and the number of fish in the stream will decrease.​

Acid rain is a form of rain with high concentration of hydrogen ions and is acidic in nature. pH of these rains is low and pH is the negative logarithmic of hydrogen ion concentration. It is known as power of hydrogen.

The animal which has the lowest value of pH will be able to tolerate the acid rain more and will be last to die. From the tolerance range of the animals, frogs has the lowest pH for survival which is 4 and it can bear more acid rain than the rest of the animals will be the last to die.

Therefore, The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease.​ Thus, option D is correct.

Learn more about acid rain on:

https://brainly.com/question/11543614

#SPJ2

explain how the genus and species name of an organism is properly written

Answers

Answer: The binomial system of nomenclature is structured so that the scientific name of a plant consists of two names: (1) the genus or generic name, and (2) the specific epithet or species name. ... The genus name is always underlined or italicized. The first letter of the genus name is always capitalized.

Explanation:

Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!

What do agriculture and urbanization have in common?

Answers

Answer:

Agriculture and urbanization both have the goal of expanding human value of living.

Explanation:

Answer:

Explanation:

Basically both of them benefit each other .

Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands.  It can also bring major challenges for urban and rural food security.

Hope this helped !

Outline the process of the Carbon Cycle.

Answers

Answer:

Carbon Cycle Definition

Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.

Carbon Cycle Steps

Following are the major steps involved in the process of the carbon cycle:

Carbon present in the atmosphere is absorbed by plants for photosynthesis.

These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.

These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.

Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.

These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.

Hope it helps!!!

Acid rain is caused by: *
*
O
a. Mass amount of CO2 in the atmosphere
O b. Reduction of pollutants
O c. Organisms that release acid into the atmosphere
O d. Planting more trees

Answers

Answer:

Mass amount of CO2 in the atmosphere

I need help on this one!​

Answers

Answer:

Classify I beilieve!

Explanation: You would need to do this because in order for you to study it you would have to classify them.

Why do we use pH and the pH scale?

Answers

Answer:

We use pH as a measurement of how acidic something is. pH scale is what we use to determine how acidic it is. i tried hope it helps:)

Explanation:

Arturo ran a 3,000-meter race. His running time from start to finish was 10 minutes. What was Arturo's average speed?

Answers

Answer:

300 meters/min

Explanation:

average speed = distance / time

(3000 m) / (10 min) = 300 meter per minute

if you need it in meters/sec then just multiply 10 by 60 first and then continue

(3000 m) / (600 sec) = 5 m/s

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

What is the function of cilia in the respiratory system? A. Move gases into the blood. B. Move food into the stomach. C. Move mucus into the throat. D. Move air into the lungs

Answers

the correct answer is c

Answer:

C or B sorry if I didn't help you

Explanation:

have a great day buddy

Viruses differ from bacteria cells in that all viruses -

A)Causes insect-borne disease

B)Have rigid cell walls

C)Can be destroyed by antibiotics

D)Must be reproduced in living cells

Answers

Answer:

D) Must be reproduced in living cells

What makes an isotope radioactive? Are all isotopes radioactive?

Answers

Answer:

Radioactive Elements

In elements with more than 83 protons, all of the isotopes are radioactive. ... The force of repulsion among all those protons makes the nuclei unstable. Elements with more than 92 protons have such unstable nuclei that they don't even exist in nature.

Explanation:

hope it helps you

follow me for more

I'm willing to help

Why does Mr. Brunner care for Percy so much?

Answers

because he is watching over percy, and mr.brunner is actually chiron, a cenataur, and was taking percy to camp half blood

GIVING BRAINLIEST AND EXTRA POINTS!!


The octopus can change its coloring to blend into its environment, and the sweet pinesap plant appears to look like dead leaves on the ground. How do these adaptations help the plant and animal survive?

A) They protect them from predators.
B) They protect them from the environment.
C) They allow them to stand out.
D) They allow them to reproduce.

Answers

I think the answer is A, they protect them from predators
it’s a it protects them from predators

Organisms such as yeast can reproduce through mitotic division. During this type of reproduction, nondisjunction is possible.
True
False

Answers

I believe that it is true
i think it is true because true

Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.

Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.

Answers

Answer:

I'm in school I'll help you when get home around 4:30

A type of circuit that has only one path is called a —

Group of answer choices

series circuit

parallel circuit

open circuit

closed circuit

Answers

The answer is series circuit.

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

The owl is a nocturnal hunter of small mammals, insects, and other birds. An owl is an example of
A. Producer
B omnivore
C carnivore
D decomposer

Answers

Answer:

C carnivore:)

Explanation:

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

What are the five main phases of the cell cycle? What are the main events in each?

Answers

Answer:

In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.

Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.

Explanation:

good luck

please mark me as a brainliest

Many scientific explanations for the origin of DNA and life have been proposed over the years. These hypotheses explain how
inorganic molecules became organic monomers, such as amino acids, sugars, phosphates, and bases. But this still didn't explain
where living things came from. If macromolecules were able to form on early Earth, this still leaves us with the question of how
the polymers would have become self-replicating, a basic criteria for life. There are several ideas but little certainty. Some of the
common ideas include: the RNA world hypothesis, the genes first hypothesis, and the metabolism first hypothesis."
Which of these statements is proposed by the genes first hypothesis?
A)
RNA is highly stable.
B)
The first life forms were self-replicating nucleic acids, such as RNA or DNA
RNA is able to store and pass on genetic information.
D)
RNA contains less nitrogen bases than DNA and thus, is a simpler molecule.
E)
Ribosomal RNA (TRNA) and transfer RNA (TRNA) are the primary molecules
responsible for protein synthesis.

Answers

The first life forms were self-replicating nucleic acids, such as RNA or DNA, RNA is able to store and pass on genetic information.

What is the difference between RNA and DNA?

There are two differences that determine DNA from RNA,

(a) RNA contains the sugar ribose, while DNA contains the slightly different sugar deoxyribose, and

(b) RNA has the nucleobase uracil while DNA contains thymine.

Thus, options, A and C are correct, RNA is adapt of both storing genetic data and catalyzing chemical responses.

To learn more about the RNA click here:

https://brainly.com/question/13868647

Lysogenic viruses do not

Answers

Answer:

Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.

Explanation:

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.

Answers

Answer:

C is the best answer

Explanation:

the dominate trait is in 3 of the four boxes

There is a 75% chance that each offspring will be tall. Therefore option C is correct.

When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.

The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.

The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.

Therefore option C  There is a 75% chance that each offspring will be tall is correct.

Know more about genotype:

https://brainly.com/question/31515990

#SPJ5

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

What type of bond holds nitrogen bases together? And, how many of these hold Guanine and Cytocine together?

Answers

hydrogen bonds help hold the 2 chains of the DNA double helix together

Please Help I willl mark Brainlist Please

Answers

Answer:

4 I think

Explanation:

The cytoplasm is home to many activities of the cell as it contains molecules, enzymes that are crucial in the break down of the waste. The cytoplasm also assists in metabolic activities. Cytoplasm provides shape to the cell. It fills up the cells thus enabling the organelles to remain in their position.

The products in our society that contribute the most waste are those that are _____.

Answers

Answer:

disposable

Explanation:

Biodegradable products do not really present any problems because they can decompose on their own, thus they do not create any pollution. Aluminum is not as dangerous to the environment as plastics, for example.

Other Questions
V Les opinions. a) Complete these sentences with the CORRECT FORM of the provide adjectives ( Correct when necessary) . b) GIVE its OPPOSITE(10.5) Modle: Graldine est (gnreux)__gnreuse _____ nest-ce pas? Non, elle est assez_______ goste_____1. Jacqueline est ( gros)________________n'est-ce pas ? Non, elle est assez_______________________________.2. Ta colocataire est ( naif ) _________________n'est-ce pas? Non, elle est plutt______________________________. 3. Sylvie et Brigitte sont ( pantouflard ) ______________________n'est-ce pas? Non, elles sont trs ________________________________________. 4. Tes parents sont ( vieux) ____________________n'est-ce pas? Non, ils sont encore(still)_______________________________. 5. Ses cheveux sont ( long et fris ) _____________________n'est-ce pas? Non, ils sont __________________________________. 6. Sophie est assez ( travailleur ) ______________________n'est-ce pas? Pas du tout, elle est trs _______________________7. Cest un (vieux) _________________________ ordinateur nest-ce pas ? Non, cest un ________________________________ ordinateur. Workers in the mid-1800s tried to pressure their employers to make changes by staging refusals to work called please answer asap! thanks :)) Based on Newton's law of motion, which combination of rocket bodies and engine will result in the acceleration of 40 m/s ^2 at the start of the launch? School Uniforms Should Be Adopted Adopting rules about school uniforms is a good idea for several reasons. If all students wear the same clothes, they will look the same. Students will not pick on one another for the clothes they wear because everyone will be dressed alike. School uniforms also can help families save time in the morning. Some students waste a lot of time deciding what to wear to school each day. School uniforms would fix this problem. Students would not have to make a choice because they would be allowed to wear only one thing. Uniforms could also help students earn better grades. Some students are so concerned with what their friends are wearing that they do not pay attention to their teachers. Students would not have this problem if they were dressed the same way. Uniforms are good for students, families, and schools. Read this persuasive essay on the reasons students should wear uniforms. Which type of supporting evidence could be added to make this essay stronger? A) Interviews with students who wear uniforms. B) Quotations from managers of clothing stores. C) Statistics about the number of males and females at your school. D) Anecdotes from students on their schools' extracurricular activities. PLZ HELP ILL GIVE 200 POINTS BECUSE I HAVE A LOT OF POINTS What is the linear momentum of a car of mass 1000 kg that is moving at a speed of 20 m/s?O50 kg m/s0.02 kg m/s20000 kg m/s2000 kg m/sOd What was the Hanoi Hilton? the North Vietnamese military headquarters the target of American air attacks during the Christmas bombing a prison built by the Vietminh to hold French soldiers captured at Dien Bien Phu the most notorious of the facilities in North Vietnam where American POWs were held What is the equation of the line that passes through the point ( 0.5 , 8 ) and has a slope of 5 Please someone check how much questions I ask for this please someone help its really late were I am and I stay every night asking for all I get is links that are not good and people lying about the answer if I dont do this I Will fail!!!!!! NO LINKS NO LYING Which trigonometric function can equal or begreater than 1.000? Two legs of a right triangle each havea length of 5 cm. What is the length ofthe third side of the triangle, to thenearest whole number? Evaluate the extent to which nationalism contributed to the collapse of the Ottoman Empire in the early twentieth century. A teenager has 8 tee shirts, 2 belts, and 5 pairs of jeans. How many different outfits can he wear, assuming that he must wear a belt to keep those pants up and keep that shirt tucked in? [Help asap, will mark brainliest] Find the area of the right triangle.Be sure to include the correct unit in your answer. Proper golf etiquette states there should be no more than _________ players in your party.4653 Hypothetically, if a slave owner dies, what would happen to his slaves? What is the molarity of a solution containing 52.6g of NaOH dissolved in 2.5L of water? Please answer me. I have exam. Which statements about Saddam Hussein are accurate? Check all that apply.1-He was a dictator.2-He was president of Iran.3-He was overthrown.4-He invaded Iraq in 1980.5-He committed war crimes. Please help! I will give brainliest!