In 2010 Only 20% of drug overdose deaths in the United States were related to prescription drug abuse.
TRUE OR FALSE

Answers

Answer 1

Answer:

False

Explanation:


Related Questions

describe what heat stroke does to the body and a situation where it's more likely to affect someone performing a physical activity.

Answers

Answer:

The complications vary depending on how long the body temperature has been elevated

Explanation:

At extremely high temperatures, the body proteins and cell membranes, especially in the brain, begin to malfunction or be destroyed due to the lack of maintainging homeostasis.

At worst, heat stroke can cause Vital organ damage, or cause them to swell (especially the brain) causing permanent damage. Heat stroke can also cause the breakdown of the cardiac muscle cells and blood vessels.

So, in short, the longer the time spent in the sun or in a hot enviornment with no breaks, the worse the concequences from heat stroke are going to be.

An individual will only feel stress in negative situations.
Please select the best answer from the choices provided.
ОТ
OF

Answers

Answer:

It False i got it right on mine

Answer:

Its false my boi

Explanation:

I did the test so dont worry

According to the text, these two major systems are very active during the body's stress response:
a
6
OOOO
digestive and skeletal
reproductive and urinary
endocrine and nervous
integumentary and respiratory
C
d

Answers

Answer:

Endocrine and Nervous system

Explanation:

Endocrine and Nervous system

The nervous system is what is responsible for the fight or flight response in every living animal, and so that is one of the major body systems everyone should think of when the body is enacting a stress response to a stimulus.

The SNS (Sympathetic Nervous System) also releases instruction to flood the body with hormones like adrenaline to help the animal either fight or run.

The endocrine however signals to the pituitary gland in the brain to increase the production of Cortisol (Stress hormone), otherwise known as a steroid hormone that regulates a lot of other body system as well, the Cortisol is another large factor in Fight or Flight response.

I hope this helps!

____________________ ඞ_____________________ bYE dAD yOu waS SuS aNyWAys

Answers

Answer:

He gay

Explanation: he just gay

yes i agreee for sure mx

What is the main purpose of a cover letter? A. To list all the classes you took in high school ОО O B. To showcase your personality O c. To give a table of contents for your portfolio O D. To explain why you are interested in and qualified for a job​

Answers

The answer is D it sounds more relevant than the rest

Can anyone give me a hand with This one

Answers

i believe the correct answer is amino acids

Why shouldn’t you use your thumb when taking a pulse ?

Answers

Answer: Because your thumb has a pulse and when you go to check it you might feel it I hope this helps if you can pls mark brainliest

Explanation:

Please help my lil' sis
What are the two major arteries you can use to manually take your heart rate?

Answers

Answer:

I cant tell if this is real or not.

Explanation:

its radial and carotid arteries

Answer:

Simply lay your index and third fingers on the inside of your wrist below the base of your thumb, between the bone and the tendon. This spot is over the radial artery. When you feel the thump of your pulse, count the beats for 15 seconds.

Explanation:

Which is an appropriate way to minimize cyberbullying?

A. use sites that look fun and interesting
B. stay away from chat rooms
C. friend as many people as possible
D. post in open forums

Answers

Answer:

The answer is B. Stay away from chat rooms.

Explanation:

The simple explanation is, you should stay away from chat rooms because if you are in a chat room it is very easy for cyberbullying to take place.

Answer:

(B)

Explanation:

Edge 2022

5.HOW MUCH WORSE IS CIGAR SMOKE THAN CIGARETTE SMOKE?

Answers

Cigars are not a safer alternative than cigarettes, they both have nicotine in them. It can cause cancer of the throat and the mouth even if you do not inhale it. Cigars have much more nicotine than cigarettes leaving it more dangerous to smoke cigars.

A depressant slows the central nervous system and effects motor skills
by slowing reaction
Your answer

Answers

Answer:

Slows down the central nervous system. Effects motor skills, impairs vision, clear things, and good judgement

Explanation: When consumed even in small amounts, it increases the number of neurotransmitters in the brain responsible for slowing down neuron-to-neuron communications. Under the influence of this change, brain activity decreases.

Which health care professionals are not specialists
A. cardiologist
B. primary care provider
C. pediatrician
D. allergist

Answers

Answer:

the answer is b primary care

Explanation:

the answer is b primary care

what type of connective tissue makes up solid organs ? ​

Answers

Answer:

Dense regular connective tissue, which forms organized structures, is a major functional component of tendons, ligaments and aponeuroses, and is also found in highly specialized organs such as the cornea. Elastic fibers, made from elastin and fibrillin, also provide resistance to stretch forces.

Which of the following is an example of resilience? Giving up when something does not go well Doing poorly on a test and asking the teacher to explain your errors Telling your friends that you expect them to do their best at all times Choosing to focus on the activities that are easy for you and you do well

Answers

Answer:

the second one!!

Explanation:

Answer:

B

Explanation:

:)

Kendra is a nurse who works in a medical office. She has had a big disagreement with her employer, the physician who owns the medical office. What is most likely to
happen when her professional relationship goes bad?
A.
She could be transferred to a different department.
B.
She could lose networking opportunities.
She could lose her job at that medical office.
C.
D.
She could be denied vacation time.

Answers

C? she could lose her job at the medical office

Answer:

This is for multiple choice a ,b, d, e ,f  i think

Explanation:

these are health information based on customs and superstition​

Answers

Answer:

"Unreliable source of information" seems to be the correct approach.

Explanation:

In general, health knowledge based on ignorance and practice is viewed as an inaccurate collection of knowledge. Typically, credible references are mostly from health manuals and physicians. They are not accurate because their scientific community has not been confirmed.The medical data throughout this situation is typically transmitted by word of mouth from era to era. We ought to be responsible when it comes regarding healthcare details whenever it applies to aspects of life including death.

The health information that are based on customs and superstition​ is known as unreliable source of information.

Unreliable source of information simply has to do with the health related information that are wrongly believed by the people. These are the information that are believed by people due to their ignorance.

An example is the belief that one has to close their eyes when sneezing so that the eyes will not fall off. This is untrue. These are believed based on ignorance.

In order to get accurate information about a health related issue, it's vital for the person to meet a doctor.

Read related link on:

https://brainly.com/question/11711880

Decide whether each example represents performance-related fitness or non-performance-related fitness, Drag the
items on the left to the correct location on the right
non performance related fitness
physiological fitness
performance related fitness
health-related fitness
bone strength
skill-related fitness
body circumference

Answers

hope this helps :)))

The correct match is non performance related fitness includes physiological fitness, bone strength, body circumference. While, performance related fitness includes health-related fitness, and skill-related fitness.

What is performance related fitness?

Skill- or performance-related fitness entails developing abilities that will improve one's performance in athletic or sporting events. Health-related fitness entails developing and maintaining physical fitness.

Physical fitness can be divided into two categories: health-related fitness and skill-related fitness. Skill-related fitness is your ability to perform physical tasks efficiently as they relate to a specific sport, whereas health-related fitness is your day-to-day activities.

Physiological fitness, bone strength, and body circumference are examples of non-performance related fitness. While performance-related fitness encompasses both health-related and skill-related fitness.

Thus, above mentioned is the match for the given scenario.

For more details regarding fitness program, visit:

https://brainly.com/question/8860814

#SPJ2

Health services managers are often responsible for:
O Creating work schedules for staff
Managing finances, including patient billing
O Meeting with medical staff and department heads
All of the above

Answers

Answer:

All of the above

Explanation:

Health services managers are very important in every healthcare facility. They're responsible for planning, directing and harmonizing/organizing the health services. They're expected to do several things such as: creating work schedules for staff, managing finances such as the patient's billing information, coordinate with the medical staff and the department heads, monitor the funding and budget of the healthcare facility, organize records, etc. So, this explains the answer above (all of the above).

In order to do these things, they have to work together with the healthcare professionals (doctors, nurses, laboratory technicians, etc.)

What is the best patient body position when conducting peak flow measurements?

Answers

standing upright!!
WHY?
Monitoring peak expiratory flow provides an objective measure of dysfunction in patients with asthma in the home, emergency department, and hospital. The ideal patient posture for peak expiratory flow measurement is standing upright, but in hospitalized patients, it is often measured with the patient semi-recumbent.

Which of the following is not a problem associated with the Olympic Games?
Judging

Politics

Commercialism

All of the choices are problems

Answers

i would say all the choices are problems

Which of the following strategies for addressing interpersonal conflict is most recommended by experts? O A. Collaboration O B. Avoidance O c. Compromise O D. Competition​

Answers

Answer: A

Explanation:

Answer: colllaboration

Explanation:

Letter A

Poor food is ? Is the main part of ? In the world

Answers

Answer:

poor food means in the food there are low nutrients and low energy.

yes it was eaten in world war 2 and3

Answer:

Distribution and malnutrition

Explanation:

how do I be happy? ​

Answers

Answer:

Positive Vibes

I guess...

Explanation:

wait is this a serious question???

Answer:

Make time to do things you enjoy doing. Find new hobbies. You could try mediation, exercise and eating healthy too. If you need to talk to someone about an issue you may want to consider a therapist. Have a good day! :)

Explanation:

How can setting goals help you take control over your health and fitness?

Answers

Answer:

Setting goals can help to lead you in the right direction of what you want to accomplish. You can also find clarity in your decision making.

Explanation:

what does fv stand for

Answers

Answer:

I believe it is front view

Explanation:

Answer:

FV stands for future value

Explanation:

Choosing to walk or ride your bike to work can positively affect your physical fitness.
Please select the best answer from the choices provided.
A T
B F

Answers

Answer:

True

Explanation:

Section 1557 of the Affordable Care Act applies to

Answers

it makes sure that health programs or facilities don’t receive federal funds from discriminating based on race, color, national origin, age, disability, or sex.

Maureen is assessing a patient who doesn't feel comfortable in medical settings and prefers home remedies over prescribed medications. Which of the following comments demonstrates Maureen's client-centered approach to avoiding conflict? O A. "Home remedies actually rarely treat illnesses." O B. "You must be frustrated. What remedies have you used so far to treat your illness?" C. "We are medical staff members and know how to best treat your illness llll D. "Please let us prescribe you an antibiotic."​

Answers

Answer:

"You must be frustrated. What remedies have you used so far to treat your illness?"

Explanation:

Hi there!

Reflecting on the client's situations will most likely not cause a conflict. "Home remedies actually rarely treat illness" will make the client feel like they don't know what they are talking about. "We are medical staff members and know how to best treat your illness" will make it sound like Maureen and her staff are better and know more than the client. "Please let us perscribe you an antibiotic" won't do it either, because the client will resist in such treatment.

However, "You must be frustrated. What remedies have you used so far to treat your illness?" will reflect on the client's situation and make them feel heard. It will sympatize on their scenario and give them a chance to explain themselves. Therefore, it is the best option.

If you enjoyed my answer, I'd appreciate it if you rated it and give it a Thanks!

Have a great day!

Answer: "You must be frustrated. What remedies have you used so far to treat your illness?"

Explanation: took the quiz

Which of the following are scarce?
O all of these
pleasant working conditions
o low-cost housing
O free time for recreation

Answers

Answer:All of these (I think)

Identify the skills that can be improved through
professional development. Check all of the boxes
that apply.
interpersonal skills
job-specific skills
job search skills
problem solving skills
RETRY

Answers

Answer:

Job-specific

Problem solving skills

Explanation:

.

Answer:

a, b, and d

Explanation:

edge2021

Other Questions
How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change? can you plzzzzzzzzzzzz help me What is 6/20 of a dollar BRAINLIEST IS RIGHT