In 1734 a group of Australian protesters known as Salzburgers arrived in the Georgia colony. What was the name of the settelment they built 25 miles northwest of the savannah

Answers

Answer 1

Answer:

Ebenezer.

Explanation:

The Georgian Salzburgers were a group of Protestant families who were expelled from Salzburg by the Archbishop during the Catholic Counterreformation. While some went to Prussia and the Netherlands, the rest went to America.

In 1734, the group of Salburgers arrived by ship at the mouth of the Savannah River. There, they began to establish a settlement nearby the lands of the Uchee Indians. This settlement was given the biblical name "Ebenezer" which means "stone of help".


Related Questions

what types of checks and balances does the executive branch have over the judicial branch?

Answers

Answer:

Other checks and balances include:. Executive over the judicial branch. The president appoints all federal judges. legislative branch must approve appointments that the president makes; the Senate must approve treatjes that the president makes; and the legislative branch may investigate the executive branch.

Explanation:

btw private message me if you need a homework sheet completed i do homework for 1-5 dollars on discord

WHY do politicians & others try to limit, or make it difficult to vote? Who benefits when people are denied the right to vote—or simply cannot vote in elections? What are the downsides to making it easy to vote (it is easy to bank online, pay bills online, buy a vehicle online, enroll in college online—why can’t we vote online?)

Answers

Answer:

Explanation:

I think you really ought to become familiar with the civil rights movement, particularly if you are an American. The issue in the 60s began as an issue that centered around voting.

Let's start with the fact that in the 60s, there was no such thing as on line. Let's also begin by saying that in the 60s, when the colored went to register, they were asked "qualifying questions" that no one knew the answer to, probably not even the person asking them. Things like if you lived in Alabama you might be asked how many counties there were and what are they.

Think of why people might withhold the vote. The colored in many counties outnumbered the whites. They could elect sheriffs council members, judges, and any other elected official.

There are enough problems with voting without adding the need to see who was casting the ballot. Think of what can be done. You can set up an email address for six people and let all six vote.

Voting is a hard fought for right. People have died for it. It's worth a little bit of inconvenience to make sure it is as honest as it can be made.

The Election of 1828 is known for

Question 7 options:

a- the positive tone of its campaign ads.


b- the controversy of elector votes.


c- the issue of abolition in Kansas.


d- the negativity of its campaign ads.

Answers

Answer:

Pretty sure its C

Explanation:

Can someone help me it’s timed!!!! Help me

Answers

Answer:

Given an assessment

Explanation:

No explanation

What is Imperialism ?(world history)

Answers

Answer: Imperialism is a policy of extending a country's power and influence through diplomacy or military force. Imperialism is typically ruled by an emperor.

Imperialism is a policy or ideology of extending the rule over peoples and other countries, for extending political and economic access, power and control, often through employing hard power, especially military force, but also soft power.

Trace the development and spread of Hinduism through trading.

Answers

Answer:

as i am hindu i can explain it

THEN THE VASCODIGA MA COME TO INDIA NEARLY 1494 HINDUSTAN SPREAD OUT FROM INDIA BECAUSE OF FOLLOWING REASONS

1 FRENCH BRITISH AND PORTUGUESE AND DUTCH TRADES

2 BECAUSE OF SLAVE TRADE AND BONDED LABOUR

3 ENGLISH EDUCATION SPREAD AND HINDUS LIKE ARVINDO AND VIVEKANAND SPREAD IT IN WEST .

4 BECAUSE OF FREEDOM FIGHTERS THEY LIVE THERE LIFE IN BRITAIN AND JAPAN ETC

what caused the central government to gain so much more power

Answers

Answer:

Armed rebellion in the newly-formed United States of America led to the creation of a stronger central government.

!!URGENT!!
Explain the 7 steps in the process of amending the Florida Constitution.​

Answers

Answer:

DECLARATION OF RIGHTS

GENERAL PROVISIONS

LEGISLATURE EXECUTIVE

JUDICIARY

SUFFRAGE AND ELECTIONS

FINANCE AND TAXATION

Why is this so urgent?

In "To Build a Fire," the man succeeds in building a fire after having fallen into the water, only to have the fire doused by a load of snow that falls off the tree boughs above it. This is an example of _____.

Answers

Answer:

Irony

Explanation:

Given that Irony is a literary term that describes the situation of things or an occurrence that appears intentionally different to what one expects and is most of the time engaging as a result.

Hence, in this case, following the man's success of building a fire, the dousing of the fire by a load of snow was unexpected of him at that time. This shows a tragic irony that must have affected the man's expectations.

Therefore, the correct answer in this case is IRONY.

Match each outcome with a weakness of the Articles of Confederation.

Tiles
The federal government couldn’t
levy taxes.
Congress had no power to regulate
foreign trade.
The approval of nine states was needed
to pass laws.
All 13 states needed to approve
amendments to the Articles.
There was no national court.

Pairs
created conflict among states and problems
with trading with other countries

no practical way to change the powers of
government

no way to settle disputes among the states

government always short of money

made enacting laws difficult

Answers

Answer:

created conflict among states and problems with trading with other countries -> Congress had no power to regulate forign trade

no practical way to change the powers of government -> All 13 states needed to approve amendments to the Articles

no way to settle disputes among the states -> There was no national court

government always short of money -> The federal government couldn't levy taxes

made enacting laws difficult -> The approval of nine states was needed to pass laws

Explanation:

Correct answers to Plato

Due to various weaknesses in Articles of Confederation outcomes were not viable to ascertain its maintainability before the US Constitution.

What is Articles of Confederation?

With time, the shortcomings of the Articles of Confederation were exposed; state governments eager to hold onto their authority gave Congress little respect and no support. Without the states' willing cooperation, Congress could not generate money, control trade, or pursue foreign policy.

On the basis of such weaknesses in Articles of Confederation the pair of tiles with its outcomes made as below:

a) Created conflict among states and problems with trading with other countries -> Congress had no power to regulate foreign trade.

b) no practical way to change the powers of government -> All 13 states needed to approve amendments to the Articles.

c) no way to settle disputes among the states -> There was no national court.

d) government always short of money -> The federal government couldn't levy taxes.

e) made enacting laws difficult -> The approval of nine states was needed to pass laws.

Thus due to several discrepancies found in the Articles of Confederation it get less reliable for Congress.

Learn more about Articles of Confederation refer:

https://brainly.com/question/13608970

#SPJ2

Is the art of storytelling mythos or logos?

Answers

Answer:

I would say Mythos I'm not sure though

Explanation:

Good Lock hope this helps!

Which is the last step in amending the U.S. Constitution?

(A)The voters approve the amendment in a national election.

(B)The president signs the amendment in a public ceremony.

(C)Three-fourths of the state legislatures ratify the amendment.

(D)Two-thirds of both houses of Congress ratify the amendment.

Will give brainlyist 20 points!!

Answers

Answer:

C - Three-fourths of the state legislatures ratify the amendment.

Explanation:

U.S. CONSTITUTION, ARTICLE V:

The Congress, whenever two thirds of both houses shall deem it necessary, shall propose amendments to  this Constitution, or, on the application of the legislatures of two thirds of the several states, shall call a  convention for proposing amendments, which, in either case, shall be valid to all intents and purposes, as  part of this Constitution, when ratified by the legislatures of three fourths of the several states, or by  conventions in three fourths thereof, as the one or the other mode of ratification may be proposed by the  Congress; provided that no amendment which may be made prior to the year one thousand eight  hundred and eight shall in any manner affect the first and fourth clauses in the ninth section of the first  article; and that no state, without its consent, shall be deprived of its equal suffrage in the Senate. (Refrenced from https://www.ncsl.org/documents/summit/summit2013/online-resources/SenDavidLong.pdf)

Prior to 1917, many Americans did not support the country being involved in what would soon be called World War I. Which of these
statements would have been MOST likely to have been made by a such a person?
A)
"The United States is a nation of immigrants."
B)
"The war is a European issue and is not a threat to the United States."
C) "The Soviet Union is a bigger threat to the United States than Germany."
D)
"The attack on Pearl Harbor was terrible, but Hawaii is a military outpost.
not a state

Answers

Answer:

B) The war is a European issue

How did Henry Clay believe his American System would improve the U.S. economy?

A. By encouraging Americans to start small family farms

B. By helping struggling farmers find new jobs

C. By helping to increase manufacturing

D. By helping Americans purchase more foregin goods

Answers

Answer:

c. increasing manufacturing

Explanation:

he was sick of getting cheap imported goods from other countries

Answer:

C for ap*x

Explanation:

did it for the 34 points

what did the concordat of worms accomplish? check all that apply

Answers

Answer:

The emperor was given the power to veto the pope's appointment of bishops. Henry V was recognized by the church as the lawful emperor. The emperor recognized the church's authority to appoint bishops.

Answer:

B,D,E or 2,4,5

Explanation:

Life on the Silk Road
List details for each sense in its column.

See Hear Touch Taste Smell

Answers

Where is the pictures or sum ?

Psychoanalysis was a method of treating patients with mental illnesses, created by was and that help us to understand our unconscious thoughts.

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to attach the options of the question. Without the specific options, we could include any answer that could fit the idea.

However, trying to help you, we did some research and can comment on the following.

Psychoanalysis was a method of treating patients with mental illnesses, created by Sigmund Freud. He believed human behavior was irrational and that dreams help us to understand our unconscious thoughts.

Sigmund Freud (1856-1939) was a neurologist from Austria, whose main lacy was the creation of Psychoanalysis, a method, therapy, or technique aimed to understand the unconscious mind and help patients to treat mental disorders.

At the beginning of 1890, Sigmund Freud named his school of thought Psychoanalysis and did deep research on the meaning of dreams and how to interpret their meanings to understand the unconscious mind of his patients.  

what is the importance of the First Battle of Bull Run?​

Answers

Explanation:

The First Battle of Bull Run (called First Manassas in the South) cost some 3,000 Union casualties, compared with 1,750 for the Confederates. Its outcome sent northerners who had expected a quick, decisive victory reeling, and gave rejoicing southerners a false hope that they themselves could pull off a swift victory

Answer:

The battle ended the hopes for a short war.

Explanation:

I just took the quiz and it's right. I hope this helps! :)


BRAINIEST ANSWER :)
please help!!

Answers

Can you please tell me at what point of the war you quiz is taking about

In 1973, Mary Hill of the Muskogee Indian Nation told an interviewer some of the stories her grandmother Sallie Farney had told her about the Trail of Tears. Read the given excerpt from the interview.

The command for a removal came unexpectedly upon most of us…Wagons stopped at our home and the men in charge commanded us to gather what few belongings could be crowded into the wagons. We were to be taken away and leave our homes never to return.

Many fell by the wayside, too faint with hunger or too weak to keep up with the rest. The aged, feeble, and sick were left to perish by the wayside…

The little children piteously cried day after day from weariness, hunger, and illness. Many of the men, women, and even the children were forced to walk…Death stalked at all hours, but there was no time for proper burying of ceremonies… There were several men carrying reeds with eagle feathers attached to the end. These men continually circled around the wagon trains or during the night around the camps. These men said the reeds with feathers had been treated by the medicine men. Their purpose was to encourage the Indians not to be heavy hearted nor to think of the homes that had been left. Some of the older women sang songs that meant, "We are going to our homes and land; there is One who is above and ever watches over us; He will care for us." This song was to encourage the ever downhearted Muskogees.

Based on the excerpt, what are the two ways the Muskogee tried to help the people of their tribe remain positive during their journey?

Answers

Answer:

Explanation:

1) By circling the wagon Trains at night holding Treated Feathers to remind the Natives that perhaps they should not think of the homes they left behind, but rather hope that what they were heading towards would be better. The feathers had the added property that they were treated by the Medicine Man.

2) The older wise women sang songs that resembled hymns to encourage those on the trail that the One above them would be watch over them.

Which of the following is NOT a geographic feature that helped protect and isolate China?
A. Gobi Desert
B. Himalayan Mountains
C. Andes Mountains
D. Pacific Ocean

Answers

Answer:

Andes Mountains.

Explanation:

They're located in South America.

Answer:

C:Andes Mountains

Explanation:

Please go to our thing please.

Hopes this help.

Which of the following best describes the Dred Scott decision?
Group of answer choices

Dred Scott could not sue for freedom because he is property

Dred Scott was granted his freedom because he lived in a free state

Dred Scott was forced back into a plantation in Alabama

Dred Scott was elected into the Supreme Court because of his law background

Answers

Answer:

Your answer is:

Dred Scott could not sue for freedom because he is property

Your answer would be: Dred Scott could not sue for freedom because his property

How did romans tighten their control over judaea in a A.D. 6

Answers

Answer:

They made Judaea a Roman province and replaced the Jewish king with a roman governor.( not really sure but thats what i found )

How does Gillray depict Napoleon in his cartoon? Why do you think a British artist would portray Napoleon in this way?

Answers

Answer:

‘The enthusiasm is indescribable, when the next drawing appears; it is veritable madness. You have to make your way through the crowd with your fists’.

James Gillray, painted by Charles Turner.

A powerful asset

Caricatures, once a social curiosity, had become powerful political tools. Some of the raunchier London images of French royalty played a major role in the downfall of Louis XVI and Marie-Antoinette. Pitt’s Tory government was also acutely aware of the power of satire, and secretly put Gillray on the payroll from 1797.

One of the primary victims of Gillray’s etching knife was Napoleon, who was in no doubt about the potential potency of vindictive cartoons. On exile in Elba, he admitted Gillray’s caricatures were more damaging than a dozen generals.

‘Napoleon Crossing the Alps’, painted by Jacques-Louis David in 1805.

Explanation:

Napoleon was never seen in person, but Gillray's portrayal of him was so potent that it helped to create the notion of a full personality. He earned a reputation as a spoiled young man who made up for his little stature by pursuing power, battle, and conquest.

Who is Napoleon ?

Napoleon I, often known as Napoleon Bonaparte, was a French military commander and emperor who ruled over a large portion of Europe in the early 19th century. Napoleon, who was raised on the island of Corsica, advanced through the military ranks quickly during the French Revolution.

Napoleon, who was aware of the potential power of vengeful cartoons, was one of the main targets of Gillray's etching pen. He acknowledged, when in exile on Elba, that Gillray's cartoons had done more harm than a dozen generals.

To learn more about Napoleon

https://brainly.com/question/22142458

#SPj2

Between the Civil War and World War World War II) the United States became more
of an ( agricultural, industrial) ation. Powerful commercial giants called "Big Business"
developed in various industries such as oil, steel, and railroads.
Several factors led to the growth of these industries. First, advances in transportation helped
to create the national, local) markets they needed to grow. Trains and automobiles allowed products to be shipped
from one part of the country to another. At the same time the development
of ( radio, advertising ) helped to increase the demand for goods. The invention of the
( assembly line, factory ) led to lower-cost production and those savings were passed on to the consumer in the form
of ( more expensive, cheaper) goods. Finally, the fast growth in various industries led to the rise to power of several
men who came to be known as "captains of industry." John D. Rockefeller led the ( automobile, oil, steel ) industry;
Andrew Camegie led the
( automobile, oil, steel ) industry, and Henry Ford led the ( automobile, oil, steel) industry, while Comelius Vander Bilt led the (steel,railroad,oil) industry.

Answers

Answer:

Industrial

National

Advertising

Assembly line

Cheaper

Oil

Steel

Automobile

Railroad

Explanation:

What aspects do I talk about when asked about the administration of the Julio Claudian period?

Answers

The correct answer to this open question is the following.

Although there are no options attached we can say the following.

The aspects I have to talk about when asked about the administration of the Julio Claudian period are the following.

I have to say that we are referring to a period in the ancient Roman Empire that was ruled by the following Roman emperors: Tiberius ruled from 14c to 37, Caligula from 37 to 31, Claudius 37 to 41, and finally, emperor Nero from 41 to 64.

The families of Cludi Nero and Julius Caesars ruled during this period and that is it received the historical name of the Julio Claudian period. Historians agree that this was a complicated period of conflicts and tribulations between Roman families, full of conspiracies and treasons.

helpp pls I want to leave classs​

Answers

Answer:

i want to leave class 2 :((

Explanation:

Which president was the first
president to address problems in
Puerto Rico?

Answers

William McKinley is the right answer

What's the most useless talent you have?

Answers

Answer:

breathing

Explanation:

Explain how bad weather and a poor harvest impacted the people of France in the summer of 1788 and the spring of 1789?

Answers

Answer:

Due to harsh weather and the poor harvest France most likely cause widespread starvation which cause riots

Explanation:

Other Questions
Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7) PLEASE HELP ME WITH ALGEBRA! THANK YOU Explain how Japan took control of Manchuria. This is worth 16 points if you show work you will get the Brainliest answer if your unable to show work type it for your explanation plz ( no links ) How was the celebration of St. Patrick's Day connected to Ireland's struggle for nationhood? Plzz Help due today!!!